SARS-CoV-2 Spike Gene N terminal Domain targeted Sequencing 

The Automated extraction was handled using the ExiPrep™ 96 Lite (A-5250, BIONEER) with the ExiPrep™ Viral DNA/RNA extraction kit (K-4614, BIONEER).

TaqPath™ COVID‑19 CE‑IVD RT‑PCR Kit (Multiplex real-time RT-PCR test intended for qualitatively detecting nucleic acid from SARS‑CoV‑2) used for viral detection. follow the user manual recommendation as listed in the following link: https://assets.thermofisher.com/TFS-Assets/LSG/manuals/MAN0019215_TaqPathCOVID-19_CE-IVD_RT-PCR%20Kit_IFU.pdf

Results can be distinguished to:

1- samples with three positive targets for (ORF1ab, N, and S genes)

2- sample with two positive targets for (ORF1ab and N genes), negative for theS gene. Failure of Spike gene amplification is referred to as S gene target failure (SGTF) or S gene signal dropdown.

3- SGTF resulted due to 69/70 codons deletion of Valine and Histidine, respectively.

Promega GoScript™ Reverse Transcription Mix with Random Primers system (A2800) is used to generate complementary DNA. following the same kit-recommended procedure.

Quality checking is considered for all steps using the Fluorometer Quantus using Quantifluor dye

the forward primer is: SubA_21587F: CCACTAGTCTCTAGTCAGTGTGTT

Reverse primer: SubA_22344R: CCAGCTGTCCAACCTGAAGA

these primers generate an amplicon of 757bp.

Primer's preparation:

These primers were supplied by Macrogen Company in a lyophilized form. Lyophilized primers were dissolved in nuclease-free water to give a final concentration of 100pmol/μl as a stock solution. A working solution of these primers was prepared by adding 10μl of primer stock solution (stored at freezer -20 C) to 90μl of nuclease-free water to obtain a working primer solution of 10pmol/μl.

Amplification reaction carried on using the flowing calculations:

1- 10 ul of GoTag Green Master Mix, Promega ( M7122 ).

2- 1 ul of Forward primer

3- 1ul of Reverse primer

4- 6 ul of nuclease-free water

5- 2ul of cDNA template.

The following program was considered for amplification:

We use the classic gel visualization method through gel electrophoresis (100-1500 bp ladder gel marker) and gel documentation.

We referred our amplicons to a sequencing company (Macrogen, South Korea).