Exposure to Bisphenol-A and Melatonin altered the Expression of Estrogen and Androgen Receptors in Neonatal Female rats

Cage adult male wistar rats of proven fertility overnight with females in proestrous phase of the cycle.

Gestational Day 1 (GD 1) is the day detect sperm cells in the vagina. Once pregnancy is confirmed, isolate the pregnant rat in a cage to stay until parturition, with a total of 12 pregnant females being used for the study.

After parturition, recognise and group the female litters . These are the second-generation Wistar rats. They have daily subcutaneous injections from post-natal day 0 for four days (PND 0 - 3). The seven groups are administered as follows:

• I – Normal saline
• II – sesame oil and ethanol (vehicle)
• III - melatonin only (10mg/kg)
• IV – 25mg/kg BPA
• V – 25mg/kg BPA + melatonin (10mg/kg)
• VI –50mg/kg BPA
• VII – 50mg/kg BPA + melatonin (10mg/kg).

Perform all administrations in the morning, and allow all the groups to mature till adulthood day 120 ± 3 days, when they are sacrificed in the morning, between 7 a.m. and 9 a.m.

After administration of BPA and melatonin treatments, the animals are left until day 120 ± 4 days. They are euthanised by administration of 20 mg/kg body weight of ketamine intramuscularly.

Following the incision and lateral reflection of the scalp, expose the skull promptly with tissue forceps to extract the entire brain and pinpoint, collect, and place the hypothalamus, situated alongside the pituitary gland at the floor of the sella turcica) into cryovials preloaded with RNA, then they are subsequently kept frozen in liquid nitrogen tanks.

The harvested brains are the nutilized for genetic (RNA) studies. Additionally, collect the female gonads; the left ovary are for follicular count on histology, which is fixed for 48 hours in 4% paraformaldehyde, and the right ovary of each animal is homogenized in 0.25Molarity (M) ice-cold phosphate buffer followed by centrifugation of homogenates for enzyme studies.

Perform staining of the ovarian tissues in paraffin wax embedded sections according to Canene-Adams, 2013 and Haematoxylin and Eosin staining by the protocols outlined by Fischer et al., 2008. The various follicles (primary, secondary, preantral, antral, and corpora lutea are identified, counted then recorded.

Obtain the blood samples from the apex of the heart for hormonal analysis using 5mL needles and syringes.

Centrifugation for 3000rpmis used to separate the serum.

Assay plasma luteinizing hormone, follicle stimulating hormone, oestrogen, progesterone, testosterone, and Anti-Mullerian Hormone concentration measurements using the Enzyme-Linked Immunosorbent Assay (ELISA) technique and purchase ELISA kits from Monobind Inc. Lake Forest, USA, following manufacturer's guide.

This involved measuring the levels in an acidic environment, where use nitrite, upon formation, to create nitrous acid, which react with sulfanilamide to form a product. This resulting product is then coupled with N-(1-naphthyl) ethylenediamine, to give an azo dye displaying a vibrant reddish-purple color, quantifiable at 540 nm.

A unit of GPx activity is defined as the enzyme quantity necessary to catalyze the oxidation of 1nanomolar (nM)NADPH per minute at 25°C.

The SOD enzyme's capability to impede the phenazine methosulfate-mediated reduction of nitro-blue tetrazolium dye is measured by monitoring absorbance at 560 nm over a 0h 5m 0s period at 25°C.

Euro Gold Tri-Fast solution (Euro Clone) is used to prepare the RNA.

The tissue is then pulverized using a tissue homogenizer, followed by DNase treatment on the extraction samples of total RNA, such that DNA contamination from the total RNA prepared could be eliminated.

Purification (through acid phenol-chloroform), precipitation, and suspension of the RNA in distilled water (dH₂O) are then carried out.

The reverse transriptase enzyme (Invitrogen) is used for reverse transcription of total RNA, using M-MLV reverse transcriptase (Invitrogen), which involves retrotranscription of 1µg of total RNA to quantify mRNA expression in experiments.

A gently mixing of the samples through up and down pipetting and then incubate at 37°C. M-MLV RT is inactivated for 0h 15m 0s at 70°C. Keep cDNA at -20°C.

NanoDrop™ 1000 spectrophotometer is used to measure cDNA and RNA concentrations.

Nucleic acid quality is noted via absorbance ratios at 260 nm/280 nm and 260 nm/230 nm.

Measurement of the relative amounts of the transcript of a specific gene is performed using a qRT-PCR, via a two-step procedure using:

• Sybr green supermix (Biorad)- the amplification reaction and generation of melting curves of the amplicons subsequently.
• Verification of the melting curve data is running through the PCR product on 2% agarose gel.

The efficiency of the Primer is tested in reactions with six serial 1:10 dilutions of cDNA as a template to perform a calibration curve.

A	B	C	D	E
	Primers	Sequence	Expected Product (bp)
1	Nuclear receptor 1I3 (NR1I3, CAR)
	RT-mCAR-DIR	GCCATGGCTCTCTTCTCTCC	160
	RT-mCAR-REV	CTAGCAGGCCCATCAGCTTT
2	Androgen receptor (Ar)
	RT-mAr-DIR	CAGGGACCACGTTTTACCCA	229
	RT-mAr-REV	TTTCCGGAGACGACACGATG
3	Anti-mullerian hormone receptor (Amhr)
	mAmh-DIR	CTGGGAGCAAGCCCTGTTAG	180
	mAmh-REV	GGTTGAAGGGTTAGGGCGAG
4	KISS1 receptor (Kiss1r)
	mKiss1r-DIR	GCTAGTCGGGAACTCACTGG	120
	mKiss1r-REV	ACGCAGCACAGAAGGAAAGT
5	Gonadotropin-releasing hormone 1 (Gnrh1)
	mGnrh1-DIR	TGGTATCCCTTTGGCTTTCACA	192
	mGnrh1- REV	GATCCTCCTCCTTGCCCATC
6	Gonadotropin releasing hormone receptor (Gnrhr)
	mGnrhr-DIR	GCCTCAGCCTTGTCTCATGT	140
	mGnrhr-REV	TATGTTGGGCTTTCCCGGTC

Collect the data and analyze by two-way analysis of variance (ANOVA) and subsequently subjecte to Tukey’s (HSD) test of multiple comparison using GraphPad Prism v.6 (GraphPad Software, Inc., La Jolla, CA, USA).

• Express data as means ± SEM (standard error of mean).
• Statistical significance is taken as P value less than 0.05 (p<0.05).