Regulation of mitophagy by the NSL complex underlies genetic risk for Parkinson’s disease: Cell-Based in vitro Assays
Helene Plun-Favreau, Marc P.M. Soutar, Daniela Melandri, Benjamin O'Callaghan, Emily Annuario, Amy E. Monaghan, Paul J. Whiting
Parkinson’s disease
Genetic Risk
Mitophagy
NSL Complex
GWAS
KANSL1
KAT8
MAPT locus
H1 Haplotype
HCS
ASAPCRN
Abstract
Impaired mitophagy is a key causative pathway in familial Parkinson’s disease, but its relevance to idiopathic Parkinson’s disease is unclear. We used a mitophagy screening assay to evaluate the functional significance of risk genes identified through genome-wide association studies and describe the cell-based in vitro assays used.
Steps
Cell Culture and siRNA Transfection
Culture cells in Dulbecco’s Modified Eagle Medium (DMEM, Gibco, 11995-0 65) supplemented with 10% heat-inactivated foetal bovine serum (FBS, Gibco) in a humidified chamber at 37°C with 5% CO2.
For siRNA transfection, transfect cells using DharmaFECT1 transfection reagent (Dharmacon, T-2001-03) according to the manufacturer’s instructions.
High Content siRNA Screen
Cell Plating and siRNA Transfection
Dispense siRNA into Geltrex-coated 96-well CellCarrier Ultra plates (Perkin Elmer) at a final concentration of 30nanomolar (nM) using the Echo 555 acoustic liquid handler (Labcyte).
Add 25µL of DMEM containing 0.48% of DharmaFECT1 transfection reagent to each well and incubate for 0h 30m 0s.
Seed POE SHSY5Y cells using the CyBio SELMA (Analytik Jena) at 15,000 cells per well, 100 µl per well in DMEM + 10% (v/v) FBS.
Incubate cells for 72h 0m 0s in a humidified chamber at 37°C with 5% CO2.
Treat cells with 10micromolar (µM) oligomycin/10micromolar (µM) antimycin for 3h 0m 0s to induce mitophagy.
Immunoflourescence and Image Capture Analysis
Fix cells with 4% (w/v)  PFA (Sigma-Aldrich,F8775), 0h 15m 0s, Room temperature.
Remove PFA solution and wash cells 3x with PBS.
Block and permeabilise cells with 10% (v/v) FBS, 0.25Mass / % volume Triton X-100 in PBS, 1 h, RT.
Immunostain cells with rabbit anti pUb(Ser65) (Cell Signaling, 37642, 1:1000) and mouse anti TOM20 (Santa Cruz, sc-17764, 1:1000) primary antibodies in 10% (v/v) FBS/PBS,2h 0m 0s, Room temperature.
After 3x PBS washes, add AlexaFluor 568 anti-mouse and 488 anti-rabbit secondary antibodies and Hoechst 33342 (Thermo Scientific, 62249) in 10% (v/v) FBS/PBS, (1:2000 dilution for all) and incubate for 1h 0m 0s, Room temperature.
Remove secondary antibodies and wash cells 3x with PBS.
Image plates using the Opera Phenix (Perkin Elmer).
Acquire 5x fields of view and 4x 1 µm Z-planes per well, using the 40X water objective, NA1.1.
Analyse images in an automated way using the Columbus 2.8 analysis system (Perkin Elmer) to measure the integrated intensity of pUb(Ser65) within the whole cell.
First of all, load the image as a maximum projection, before segmenting to identify the nuclei using the Hoechst 33342 channel (method B).
To identify the cytoplasm, use the “Find Cytoplasm” building block (method B) on the sum of the Hoechst and Alexa 568 channels.
Identify pUb(Ser65) as spots (method B) on the Alexa 488 channel, before measuring their integrated intensity.
Screen Quality Control, Data Processing and Candidate Selection
Quality control screen plates based on the efficacy of the PINK1 siRNA control and O/A treatment window (minimum 3-fold).
Check data for edge effects using Dotmatics Vortex visualization software.
Quality control raw data using robust Z prime > 0.5.
Process data using Python for Z score calculation before visualization in Dotmatics Vortex.
Candidates should be considered a hit where Z score is ≥ 2 or ≤ -2, and where replication of efficacy is seen both within and across plates.
siRNA Libraries
Resuspend siRNAs in RNase-free water for a final concentration of  20micromolar (µM).
Add SCR, PINK1 and PLK1 or KIF11 controls to the 384-well plate at a concentration of 20micromolar (µM) before dispensing into barcoded assay-ready plates.
KANSL1 iNeuron Culture and Differentiation
Culture human induced pluripotent stem cells (hIPSCs) on Geltrex (Thermofisher) coated culture dishes in mTeSR1 (StemCell Technologies) and maintained in a humidified 37°C incubator, 5% CO2.
Differentiate isogenic KANSL1+/+ and KANSL1+/-hiPSCs into excitatory cortical neurons by doxycycline induced overexpression of murine Ngn2.
On d0 dissociate hiPSCs into a single cell suspension using accutase (Sigma).
Plate cells onto geltrex coated dishes in induction medium consisting of DMEM/F12 supplemented with 1x Glutamax, 1x non-essential amino acids (NEAAs), 1x N2-supplement (all Thermofisher) and 4µg/ml doxycycline (Sigma).
Supplement induction media with 10micromolar (µM) Y-27632 Rho Kinase inhibitor (ROCKi, Peprotech) during initial seeding.
Seed 7.5x10^5 cells per 6-well.
24h 0m 0s later (d1) and 48h 0m 0s later (d2) perform a full medium change with freshly prepared induction media without Y-27632 ROCKi.
On d3 perform a full medium change with freshly prepared N2-B27 media consisting of a 1:1 mixture of DMEM/F12:Neurobasal supplemented with 0.5x N2-supplement, 0.5x B27 supplement, 0.5x NEAAs, 0.5x Glutamax, 45micromolar (µM) 2-Mercaptoethanol (all Thermofisher), 2.7µg/ml insulin (Sigma).
Supplement N2-B27 media with 2micromolar (µM) Cytosine β-D-arabinofuranoside (ARA-C) (Sigma) on d3.
Every 3-4 days thereafter, perform a half media change with N2-B27 lacking ARA-C.
Perform a half media change with N2-B27 on d16 and collect cells for experimental assays 24 h later on d17.
CRISPRi-i3N iNeuron Culture and Differentiation
hiPSCs are cultured as outlined above for KANSL1 hiPSCs in Step 23
First transduce CRISPRi-i3N hiPSCs with lentiviral particles encoding a mCherry-reporter and sgRNA sequences targeting the promoter regions of KANSL1 , KAT8 or PINK1, or a non-targeting sgRNA control.
Then differentiated transduced cells into excitatory cortical neurons by doxycycline induced overexpression of murine Ngn2.
On d-1 dissociate CRISPRi-i3N hiPSCs into a single cell suspension using accutase and reverse transduce with sgRNA lentiviral supernatant in mTeSR1 supplemented with 5ug/ml polybrene and 10micromolar (µM) Y-27632 ROCKi.
Seed 4.5x10^5 cells onto Geltrex-coated 6-well plates.
24h 0m 0s later (d0) change media to induction media (composition outlined above in Step 26   for KANSL1 iNeurons).
24h 0m 0s later (d1) and 48h 0m 0s later (d2) perform a full medium change with freshly prepared induction media.
On d3, dissociate differentiating iNeurons into a single cell suspension using accutase (Sigma) and seed in N2-B27 media (composition outlined above in Step 28 for KANSL1 iNeurons) into Geltrex-coated 96-well CellCarrier Ultra plates for immunofluorescence (IF) (3x10^4 cells per well) and 12-well plates (5x10^5 cells per well) for biochemistry purposes.
Perform a half media change with N2-B27 the following day (d4) and every 3-4 days thereafter.
Perform a half media change with N2-B27 on d16 and collect cells for experimental assays 24 h later on d17.
Lentiviral Particle Generation
Transfect 70-90% confluent Lenti-X human embryonic kidney 293T cells (HEK293T) cultured in DMEM 10% FBS media with pMD2.G and pCMVR8.74 alongside appropriate delivery plasmids: pLV[Exp]-U6>sgRNA-hPGK>mApple (Vectorbuilder) plasmids (for sgRNA), empty pLVX-EF1α-IRES-Puro (Clontech, Takara Bio), V5-KANSL1 pLVX-EF1α-IRES-Puro, or V5-KAT8 pLV[Exp]-EF1α-IRES-Puro at a 1:1:2 molar mass ratio using Lipofectamine 3000 (Invitrogen).
The next day, perform a full media change with mTeSR1 (for sgRNA lentivirus) or DMEM 10% (v/v) FBS media and culture cells for 24h 0m 0s.
Collect the lentivirus containing mTeSR1 / DMEM 10% (v/v) FBS and dilute 1:2 with fresh mTeSR1 or 10% (v/v) FBS before filtering through 0.44 µm PES filters.
Mitochondrial Enrichment and Western Blotting
Transfect POE SHSY5Y and H4 cells with 100nanomolar (nM) siRNA and incubate for 72h 0m 0s.
Culture KANSL1 iNeurons as detailed above in Steps 23-30 .
Use whole cell lysates from POE SHSY5Y cells, H4 cells, and KANSL1 iNeurons.
For some experiments, POE SHSY5Y lysates you can first fractionate into cytoplasmic and mitochondria-enriched preparations to facilitate detection of mitochondrial localised proteins of interest.
KANSL1 and KAT8 siRNA KD Rescue
Transfect POE SHSY5Ys with 25 nM siRNA (d0) and incubate for 48 h.
Transduce siRNA KD cells with lentivirus in the presence of 10 µg/ml polybrene (d2).
Perform a full media change the following day (d3) and collect 4 days post siRNA transfection (and 2 days post lentivirus transduction) (d4).
pRab8A(Ser111) Measurements
Transfect SHSY5Y cells stably overexpressing PINK1-HA with 100 nM siRNA and incubate for 72 h.
Immunoprecipitate 200ug of protein (whole cell lysate) with Protein A Dynabeads™ (Invitrogen) prebound with 0.5ug of rabbit anti total-Rab8 antibody (Cell Signaling, 6975) at 4 °C overnight.
Elute samples from the beads by heating at 95 °C in 2x LDS supplemented with 50mM DTT for 5min.
Immunoflourescence
Reverse transfect SHSY5Y cells with 50 nM siRNA in 96-well CellCarrier Ultra plates according to the manufacturer’s instructions and incubate for 72 h.
Culture CRISPRi-i3N iNeurons as described above in Steps 31-38 .
Treat, fix and stain cells as per the screening protocol detailed above in Steps 8-13 .
For visualisation purposes, select brightness and contrast settings on the SCR (siRNA KD SHSY5Y) or no transduction (No TD) (CRISPRi-i3N iNeurons) controls and apply the same settings to all other conditions.
Present representative images as maximum projections of the channels for one field of view.
RT-qPCR
Extract total RNA from cells using the Monarch Total RNA Miniprep Kit (New England Bioscience) with inclusion of the optional on-column DNAse treatment.
Reverse transcribe RNA with SuperScript™ IV reverse transcriptase and random hexamers (Invitrogen).
Dilute the cDNA product then subject to quantitative real-time PCR (qPCR) using Fast SYBR™ Green Master Mix (Applied Biosystems) and gene specific primer pairs (See Table Below) on a QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems).
| A | B | C | D | 
|---|---|---|---|
| **** | Sequence 5'-3' | **** | |
| Gene Target | Forward | Reverse | Product Size / bp | 
| RPL18A | CCCACAACATGTACCGGGAA | TCTTGGAGTCGTGGAACTGC | 180 | 
| UBC | CTGGAAGATGGTCGTACCCTG | GGTCTTGCCAGTGAGTGTCT | 117 | 
| KANSL1 | ATCCTCCACACAGTCCCTTG | CCCCTTCTCCTCCTTACTGG | 121 | 
| KAT8 | TCACTCGCAACCAAAAGCG | GATCGCCTCATGCTCCTTCT | 107 | 
| PINK1 | GTGGAACATCTCGGCAGGTT | CCTCTCTTGGATTTTCTGTAAGTGAC | 129 | 
| PRKN | ACAAATAGTCGGAACATCACTTGCA | AACAAACTGCCGATCATTGAGTCTT | 144 | 
| MAPT | TGCAAATAGTCTACAAACCAGT | CTTGTGGGTTTCAATCTTTT | 209 | 
List of primer pairs used for RT-qPCR of target genes
Calculate relative mRNA expression levels using the 2−ΔΔCt method and RPL18A (SHSY5Y) or UBC (iNeurons) as the house-keeping gene.
Mitophagy Measurement Using mt-Keima Reporter
Reverse transfect stable mt-Keima expressing POE SHSY5Y cells with 50nanomolar (nM) siRNA in 96-well CellCarrier Ultra plates according to the manufacturer’s instructions and incubate for 72h 0m 0s.
For the assay, replace the cell medium with phenol-free DMEM + 10% FBS containing Hoechst 33342 (1:10000) and either DMSO or 1micromolar (µM)oligomycin/ 1micromolar (µM)antimycin to induce mitophagy.
Image cells immediately on the Opera Phenix (PerkinElmer) at 37°C with 5% CO2, acquiring 15x single plane fields of view, using the 63X water objective, NA1.15.
Images were analysed in an automated way using the Columbus 2.8 analysis system (Perkin Elmer) to measure the mitophagy index.
Identify cells using the nuclear signal of the Hoechst 33342 channel, before segmenting and measuring the area of the cytoplasmic and lysosomal mt-Keima.
Calculate the mitophagy index as the ratio between the total area of lysosomal mitochondria and the total area of mt-Keima (sum of the cytoplasmic and lysosomal mtKeima areas) per well.
Mitochondrial Membrane Potential Measurements using TMRM
Transfect POE SHSY5Ys with 50nanomolar (nM)siRNA in 96-well CellCarrier Ultra plates using Dharmfect1 and incubate for 72h 0m 0s.
Perform Tetramethylrhodamine, Methyl Ester, Perchlorate (TMRM) measurements in redistribution mode where a decrease in TMRM signal intensity is associated with mitochondrial membrane potential (ψm) depolarisation (confirmed post-imaging by treatment with 1micromolar (µM) Carbonyl cyanide m-chlorophenyl hydrazone, CCCP, ψm depolarising agent).
Incubate live cells in 25nanomolar (nM) TMRM (Sigma Aldrich) diluted in Hanks' Balanced Salt Solution (HBSS, Gibco) buffered with 10millimolar (mM) HEPES (Sigma Aldrich), 7.4 for 0h 40m 0s at 37°C.
Image cells on the Opera Phenix (PerkinElmer) at 37°C, acquiring confocal z-stacks for 27 fields of view across 3 individual wells per experimental condition using the 40X water objective, NA1.1.
Analyse images in an automated way using the Columbus 2.8 analysis system (Perkin Elmer) to measure the TMRM signal intensity of maximum intensity projections.
Statistical Analysis
Normalise intensity measurements from imaging experiments for each experiment.
N numbers shown in figure legends should refer to the number of independent, replicate experiments.
Within each experiment, calculate the mean values of every condition from a minimum of 3 technical replicates.
Normalise integrated density measurements from Western blot experiments to control conditions.
Wherever possible, avoid normalisation to conditions for statistical comparisons in order to maintain experimental error associated.
Subject Data to either one-way or two-way ANOVA with Dunnett's post-hoc analysis for multiple comparisons, or other appropriate statistical analysis.
Present data with error bars showing mean ± standard deviation (SD) from replicate experiments.
 
 