PCR protocol to identify an equine mutation associated with Warmblood Fragile Foal Syndrome(WFFS)
gerald.barry, Sharon Flanagan, Áine Rowe, Vivienne Duggan, Erin Markle, Maureen O’Brien
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK
The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
Warmblood Fragile Foal syndrome (WFFS) is an autosomal recessive condition that affects the maturation of collagen in affected foals. Foals affected with the disease typically die or are euthanised shortly after birth. WFFS is caused by a single nucleotide change at position 2032 of the equine PLOD1 gene, causing an impairment of the wild-type enzyme. A commercial test for the causative genetic mutation is currently available from companies operating under licence from Cornell University but it has limitations. This test requires amplification of a region of the PLOD1 gene encompassing the site of interest, followed by Sanger sequencing of that region and computational analysis. We present here the development of an alternative, real-time PCR based assay that rapidly and reliably differentiates between the wild-type and WFFS associated nucleotides without the need for sequencing, thus increasing the potential for high throughput analysis of large numbers of samples in a cost-effective manner.
Steps
DNA extraction
Hair strands (10 per extraction) are cut at a maximum length of 1 cm, including the follicular tag.
The hair is placed into a 1.5 ml Rnase, DNase-free micro-centrifuge tube followed by 300 µl of ATL Buffer, 20 µl of Proteinase K and 20ul of a 1 M DTT solution.
The sample is incubated at 56oC with occasional vortexing until the hair is completely lysed and cannot be seen anymore.
After incubation, the sample is vortexed for 15 seconds to ensure complete homogenisation.
300µl AL Buffer is added and the sample is again briefly vortexed.
300µl of ethanol (molecular grade, > 99.5% pure) is added with brief vortexing again to ensure complete mixing.
The sample mixture is pipetted into a DNeasy mini spin column and centrifuged at room temperature at 6000 x g for 1 minute. The flow through is discarded
500µl of AW1 Buffer is added and the column is centrifuged at room temperature at 6000 x g for 1 minute and the flow through discarded.
500µl of AW2 Buffer is added and the column is centrifuged at room temperature at 6000 x g for 1 minute and the flow through discarded.
The samples are centrifuged again at room temperature at 6000 x g for 1 minute to remove any excess ethanol before the extracted DNA was eluted into a clean RNase/DNase-free tube.
For elution, 100 µl of buffer AE was added to the column, allowed to incubate for 1 minute at room temperature and then centrifuged at room temperature at 6000 x g for 1 minute.
The sample is re-added to the column, re-incubated for 1 minute and then centrifuged at room temperature at 6000 x g for 1 minute.
RT-PCR
Each PCR reaction is set up as per the table below in a 96 well plate.
A | B |
---|---|
Component | Volume per 20 µl reaction |
TaqPath ProAmp Master Mix | 10 µl |
TaqMan Genotyping Assay | 0.5 µl |
Genomic DNA or NTC | 5.0 µl |
Nuclease- Free water | 4.5 µl |
Total Volume | 20 µl |
The well plate is sealed with PCR compatible optical adhesive film and centrifuged at room temperature at 220 x g for 1 minute.
The PCR running conditions are set up as per the table below. We used an Applied Biosystems 7500 RT-PCR machine.
A | B | C | D |
---|---|---|---|
PCR Step | Temperature | Time | Cycles |
Pre – Read | 60oC | 30 seconds | Hold |
Initial denaturation / Enzyme Inactivation | 95oC | 5 minutes | |
Denature | 95oC | 15 seconds | 40 |
Anneal / Extend | 60oC | 60 seconds | |
Post – Read | 60oC | 30 seconds | Hold |
Primers used are as follows:
A | B |
---|---|
Component | Sequence |
SNP Genotyping assay Forward Primer | TCCTGTTGGGAAACTGACACTTC |
SNP Genotyping assay Reverse Primer | TCGGATGGAGCAGTTGTAACG |
FAM Probe | ACAGCCCCTGCCCTG |
VIC Probe | CAGCCCCCGCCCTG |