Cell line construction and maintenance for Lyso-IP and Endo-IP analysis of amyloid precursor protein processing, version 2
Harper JW, Hankum Park, Frances V Hundley, Sharan Sharan Swarup
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK
The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
Lyso-IP is a method that allows for the isolation of lysosomes for proteomics and metabolomics (dx.doi.org/10.17504/protocols.io.bybjpskn; dx.doi.org/10.17504/protocols.io.bx9hpr36). We have developed an analogous approach for purification of early/sorting endosomes (Endo-IP). In addition, we have found that endolysosomal purification via Lyso-IP and Endo-IP can be coupled to a quantitative proteomics workflow to obtain snapshots of Amyloid Precursor Protein (APP) processing to its Aβ products (Park et al. 2022). Here, we describe methods for cell line construction and maintenance of 293 cells with TMEM192-3xHA and 3xFLAG-EEA1, which are used for lysosome and endosome purification, respectively. of patient mutations to APP promotes processing. Cells with endogenously-tagged TMEM192 and stably expressing FLAG-EEA1 are referred to as 293EL cells, for E ndo-IP and L yso-IP. These cells were also prepared in a form that has a deletion of the APP gene (293ELAPP-/-) and the same cells reconstituted with a lentivirus stably expressing a patient mutant form (APPSw;T700N) which promotes APP processing and allows functional analysis of APP processing.
Steps
Cell line maintenance
Maintain 293 cells in Dulbecco’ Modifies Eagles Medium (DMEM) with 10% fetal bovine serum and optional 1% penicillin-streptomycin. Additionally, grow 293EL cells in 1.2 µg/ml puromycin and 200 µg/ml G418 to maintain selection for 3xFLAG-EEA1 and TMEM192-3XHA, respectively.
Endogenous tagging of TMEM192 with 3xHA
For endogenous tagging of TMEM192 with 3xHA, co-transfect 293 cells with pX459 containing a gRNA (5’-AGTAGAACGTGAGAGGCTCA) targeting adjacent to the translational termination sequence in TMEM192 and pSMART containing 5’ and 3’ homology arms for TMEM192 in which the termination codon is replaced by a 3xHA epitope sequence followed by a TAA stop codon (Addgene #175777).
Identify homozygously targeted clones by immunoblotting cell extracts with α-HA and α-TMEM192. These are referred to as 293Lcells for Lyso-IP.
Stable expression of 3xFLAG-EEA1
Generate puromycin-resistant pHAGE lentiviral vectors expressing EEA1 by recombining open reading frames in pENTR vectors into a pHAGE-N-3xFLAG vector.
Infect 293Lcells with viral supernatants derived from transfection of 293T cells with pHAGE-3xFLAG-EEA1 vector (Addgene #176491) and appropriate packaging and envelope vectors. Select for viral integration with puromycin (1.2 µg/ml). Select a monoclonal population. These are referred to as 293ELcells for Endo-IP and Lyso-IP.
APP knock-out
For APP knock-out, phosphorylate and anneal oligonucleotides (Top: 5’- CACCGGCGGAATTGACAAGTTCCGA, Bottom: 5’-AAACTCGGAACTTGTCAATTCCGCC), and clone into a pX459 vector.
Transfect 293EL cells with the pX459-gRNA-APP plasmid (Addgene #176487) with Lipofectamine 3000, and select with 1.2 µg/mL of puromycin. Select monoclonal population, and confirm APP deletion by Western blotting.
Stable expression of APPsw,T700N
To create an APP (isoform 751) open reading frame: PCR amplify pENTR-APP751 (open, no stop codon) to replace W752 with a stop codon using forward primer (5'-GCAGAACTAGATCCACCCAGCTTTCTTG) and reverse primer (5'-GGGTGGATCTAGTTCTGCATCTGCTCAAAG).
Use two rounds of PCR to generate pENTR-APPSw,T700N using the following kits and primers: Sw (K651M/N652L): QuickChange II mutagenesis kit; Forward: 5'-tcggaattctgcatccagattcacttcagagatctcctccg; Reverse: 5'-cggaggagatctctgaagtgaatctggatgcagaattccga; T700N: Q5 mutagenesis kit; Forward: 5'- ATCGTCATCAACTTGGTGATG; Reverse: 5'- CACTGTCGCTATGACAAC. Transfer the APPSw,T700N open reading frame in pENTR to Gateway destination vector pHAGE-C-HA-FLAG-puro using Clonase to yield pHAGE-APPSw,T700N-puro.
Note: the stop codon in the APP open reading frame blocks translation into the HA-FLAG tag in this vector.
Prepare a stable cell line by lentiviral transduction of APPSw,T700Nto 293ELAPP-/- cells followed by monoclonal selection.
