18S V9 PCR

A	B
methodology category	omics analysis
project	Monterey Bay Time Series
purpose	time series design [OBI:0500020]
analyses	amplicon sequencing assay[OBI:0002767]
geographic location	Monterey Bay [GAZ:00002509]
broad-scale environmental context	marine biome [ENVO:00000447]
local environmental context	upwelling [ENVO:01000005]
environmental medium	sea water [ENVO:00002149]
target	18S Ribosomal RNA [NCIT:C48172]
creator	Kathleen Johnson Pitz
materials required
skills required	laboratory technician with experience in PCR
time required
personnel required	1
language	en
issued
audience	scientists
publisher	Monterey Bay Aquarium Research Institute, Chavez Lab
hasVersion
license
maturity level	Demonstrated

A	B	C	D
Jacoby Baker	MBARI		yyyy-mm-dd
Kobun Truelove	MBARI		yyyy-mm-dd
Kathleen Johnson Pitz	MBARI	0000-0002-4931-8592	2022-04-25

Version numbers start at “1.0.0” when the protocol is first completed and will increase when changes that impact the outcome of the procedure are made (patches: 1.0.1; minor changes: 1.1.0; major changes: 2.0.0). Please store all versions in the gDrive folder designated to your institute.

A	B	C
1.0.0	2022-04-25	Initial release

This is a list of other protocols deposited in your folder which should be known to users of this protocol. For example, if you create a derivative or altered protocol, you would link to the original protocol in the section below. Please include the link to each related protocol. Also include the version number of that protocol when you linked to it.

A	B	C
protocol_18S_secondary_amplification.md		yyyy-mm-dd
protocol_18S_sequencing.md		yyyy-mm-dd

This is a list of other protocols that are not in your folder which should be known to users of this protocol. These include, e.g., kit manuals. Please upload all relevant external protocols to Appendix A and link to them here.

A	B	C
Environmental DNA (eDNA) 18S metabarcoding Illumina MiSeq NGS PCR Protocol V.2 https://dx.doi.org/10.17504/protocols.io.n2vdge6 dx.doi.org/10.17504/protocols.io.n2vdge6	Collin Closek, Anni Djurhuus, Katie Pitz, Ryan Kelly, Reiko Michisaki, Kristine Walz, Hilary Starks, Francisco Chavez, Alexandria Boehm, Mya Breitbart	yyyy-mm-dd
18S Illumina Amplicon Protocol https://earthmicrobiome.org/protocols-and-standards/18s/ dx.doi.org/10.17504/protocols.io.nuvdew6	Earth Microbiome Project	yyyy-mm-dd

A	B
MBARI	Monterey Bay Aquarium Research Institute
PCR	polymerase chain reaction
NTC	no template control

A	B
amplicon	A piece of DNA or RNA that is the source and/or product of amplification or replication events (https://en.wikipedia.org/wiki/Amplicon)

This protocol is aimed at amplifying the 18S rRNA hypervariable region 9 (18S V9) in eukaryotes with a focus on microbial eukaryotes. Amplicons generated using this protocol can then be sequenced using the Illumina platform. The primers (1391F, EukBr) utilized in this protocol are based on the primer utilized in Amaral-Zettler et al. (2009), Stoek et al. (2010), and the Earth Microbiome Project (EMP).

This work was supported by NASA grant NNX14AP62A ‘National Marine Sanctuaries as Sentinel Sites for a Demonstration Marine Biodiversity Observation Network (MBON)’ funded under the National Ocean Partnership Program (NOPP RFP NOAA-NOS-IOOS-2014-2003803 in partnership between NOAA, BOEM, and NASA), and the U.S. Integrated Ocean Observing System (IOOS) Program Office.

This method uses PCR to amplify the 18S V9 region using primers 1391F and EukBr from Amaral-Zettler et al 2009 and the Earth Microbiome Project (EMP).

This method is applied because of its ability to amplify the target region (18S V9) across many different groups of organisms, the target region’s ability to discriminate between different taxa, and the common research application of this primer set allowing the data to be compared to a reference database and other published environmental datasets.

ocean [ENVO:00000015]* freshwater lake [ENVO:00000021]

1 technician

A	B	C	D	E
Durable equipment
ultraviolet light source [OBI:0002900]
PCR instrument [OBI:0000989]
electrophoresis system [OBI:0001053]
fluorometer [OBI:0400143]	FMAX Fluorometer	Molecular Devices		with SoftMaxPro v1.3.1
Consumable equipment
Agarose gel			2
Agencourt AMPure XP bead system		Beckman Coulter, USA
Quant-It Picogreen dsDNA Assay		Life Technologies
Chemicals
10% Bleach
70% Ethanol
RNase Away
Amplitaq Gold Fast PCR mastermix
molecular-biology grade water
forward and reverse primers (5 μM)

1. Disinfect work surfaces with 10% bleach, followed by 70% ethanol.
2. RNase Away and pipets with RNase Away
3. UV pipets, molecular grade water, and tube racks for 20 minutes prior to starting protocol.

PCR reactions were run in single 75ul reactions for each sample using 12-basepair Golay barcoded reverse primers [Amaral-Zettler et al. (2009), Stoek et al. (2010), Earth Microbiome Project] with Fluidigm adapters CS1 & CS2. All primers listed in the 5’ to 3’ direction.

• 3 μl DNA extract template
• 37.5 μl Amplitaq Gold Fast PCR mastermix (Applied Biosystems)
• 3 μl each of forward and reverse primers (5 μM)
• 28.5 μl molecular-biology grade water

A	B	C
Euk1391F and Fluidigm CS1	forward	ACACTGACGACATGGTTCTACAGTACACACCGCCCGTC
EukBr and Fluidigm CS2	reverse	TACGGAGCAGAGACTTGGTCTTGATCCTTCTGCAGGTTCACCTAC

PCR reactions were run in 96-well plates with a NTC run in singleton for each plate

18S thermal cycling parameters

• These parameters use a normal ramp speed

A	B	C	D
denature	95° C	10 minutes	1
denature	94° C	45 seconds	35
anneal	57° C	30 seconds	35
extension	68 °C	90 seconds	35
extension	72° C	10 minutes	1
hold	4° C	infinity	1

After PCR amplification of the marker region, PCR products were run through an agarose gel to confirm the presence of target bands and absense of non-specific amplification across environmental samples as well as the absence of amplification in no-template controls (NTCs).

1. PCR products were purified and size selected using the Agencourt AMPure XP bead system (Beckman Coulter, USA).
2. A second agarose gel was run to confirm primer removal and retention of target amplicons after purification.
3. Purified products were then quantified using Quant-It Picogreen dsDNA Assay (Life Technologies) on an fmax Molecular Devices Fluorometer with SoftMaxPro v1.3.1

Amaral-Zettler LA, McCliment EA, Ducklow HW, Huse SM (2009) A Method for Studying Protistan Diversity Using Massively Parallel Sequencing of V9 Hypervariable Regions of Small-Subunit Ribosomal RNA Genes. PLOS ONE 4(7): e6372. https://doi.org/10.1371/journal.pone.0006372

Stoeck, T., Bass, D., Nebel, M., Christen, R., Jones, M. D. M., Breiner, H.-W., & Richards, T. A. (2010). Multiple marker parallel tag environmental DNA sequencing reveals a highly complex eukaryotic community in marine anoxic water. Molecular Ecology, 19 Suppl 1, 21–31. https://doi.org/10.1111/j.1365-294X.2009.04480.x

Caporaso, J. G., Lauber, C. L., Walters, W. A., Berg-Lyons, D., Huntley, J., Fierer, N., Owens, S. M., Betley, J., Fraser, L., Bauer, M., Gormley, N., Gilbert, J. A., Smith, G., & Knight, R. (2012). Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. ISME J 6, 1621–1624. http://doi.org/10.1038/ismej.2012.8