hissPCR: A simple, single-tube overlapping amplicon-targeted Illumina sequencing assay.

Primers must be designed as shown in the figure below, if any amplicon is larger than the 2 x sequencing length, the inner portion of the amplicon will not be covered. We have developed a pipeline to assist in creating primers, which is available here: hisPCR primer design, and is used as follows.

hisPCR_primer_designer.sh \
  --name "rpob_demo" \
  --seq_cycles 300 \
  --start 100 \
  --end 800 \
  --template "ttgaccgatgaccccggttcaggcttcaccacagtgtggaacgcggtcgtctccgaacttaacggcgaccctaaggttgacgacggacccagcagtgatgctaatctcagcgctccgctgacccctcagcaaagggcttggctcaatctcgtccagccattgaccatcgtcgaggggtttgctctgttatccgtgccgagcagctttgtccaaaacgaaatcgagcgccatctgcgggccccgattaccgacgctctcagccgccgactcggacatcagatccaactcggggtccgcatcgctccgccggcgaccgacgaagccgacgacactaccgtgccgccttccgaaaatcctgctaccacatcgccagacaccacaaccgacaacgacgagattgatgacagcgctgcggcacggggcgataaccagcacagttggccaagttacttcaccgagcgcccgcacaataccgattccgctaccgctggcgtaaccagccttaaccgtcgctacacctttgatacgttcgttatcggcgcctccaaccggttcgcgcacgccgccgccttggcgatcgcagaagcacccgcccgcgcttacaaccccctgttcatctggggcgagtccggtctcggcaagacacacctgctacacgcggcaggcaactatgcccaacggttgttcccgggaatgcgggtcaaatatgtctccaccgaggaattcaccaacgacttcattaactcgctccgcgatgaccgcaaggtcgcattcaaacgcagctaccgcgacgtagacgtgctgttggtcgacgacatccaattcattgaaggcaaagagggtattcaagaggagttcttccacaccttcaacaccttgcacaatgccaacaagcaaatcgtcatctcatctgaccgcccacccaagcagctcgccaccctcgaggaccggctgagaacccgctttgagtgggggctgatcactgacgtacaaccacccgagctggagacccgcatcgccatcttgcgcaagaaagcacagatggaacggctcgcggtccccgacgatgtcctcgaactcatcgccagcagtatcgaacgcaatatccgtgaactcgagggcgcgctgatccgggtcaccgcgttcgcctcattgaacaaaacaccaatcgacaaagcgctggccgagattgtgcttcgcgatctgatcgccgacgccaacaccatgcaaatcagcgcggcgacgatcatggctgccaccgccgaatacttcgacactaccgtcgaagagcttcgcgggcccggcaagacccgagcactggcccagtcacgacagattgcgatgtacctgtgtcgtgagctcaccgatctttcgttgcccaaaatcggccaagcgttcggccgtgatcacacaaccgtcatgtacgcccaacgcaagatcctgtccgagatggccgagcgccgtgaggtctttgatcacgtcaaagaactcaccactcgcatccgtcagcgctccaagcgctag"

A	B
COMPONENT	Volume (µl)
5X Q5 Reaction Buffer	10
5X Q5 High GC Buffer	10
10 mM dNTPs	1
Q5 High-Fidelity DNA Polymerase	0.5
10µM Forward primer 1	1
10µM Reverse primer 2	1
20 mg/ml BSA	5
Template DNA (~1ng/ul)	5
Nuclease-Free Water	18.5

The total volume is 50ul at this stage

A	B	C	D
Step	Temp (C)	Time (s)	Cycles
Denaturation	98	120	1
Denaturation	98	10	10
Annealing	64	15
Extension	72	45
Extension	4	Forever	1

Cycle parameters

As soon as the sample hits 4°C, proceed to step 2.

Add the below into the reaction while at 4°C and proceed to the second PCR cycling

A	B
COMPONENT	Volume (µl)
10µM Forward primer 2	0.15
10µM Reverse primer 1	0.15
10µM Forward Illumina adapter primer	0.35
10µM Reverse Illumina adapter primer	0.35

The total volume is 51ul at this stage

A	B	C	D
Step	Temp (C)	Time (s)	Cycles
Denaturation	98	10	1
Denaturation	98	10	20
Annealing	65	15
Extension	72	30
Extension	72	120	1

Cycle parameters

Add 40µL of resuspended AMPure XP beads to each reaction in a PCR tube

Mix by pipetting 10x

Incubate 0h 5m 0s at 65Room temperature

Place on magnet

Wash 2x with 200µL freshly-prepared 70% (v/v) ethanol

Air dry for0h 0m 30s, don't allow the beads to become cracked

Remove the tubes from the magnetic rack

Add 50µL 10 mM Tris-HCl pH 8.0 with 50 mM NaCl

NOTE: The BSA in the reaction causes the beads to clump.

Flick the tubes to partially resuspend the beads

Mix by pipetting 10x

Incubate 0h 5m 0s at 65Room temperature

Place on the magnet, aspirate 50µL of the eluant into a new tube

Run 10µL on a 0.8% agarose gel

Library quantification can be done using a commercial kit such as the KAPA Library Quantification Kits or using the below custom protocol. KAPA Library Quantification Kits or using the below custom protocol.

Dilute the cleaned up amplicons 1:100.

Make the master mix below using Illumina_quant_Inner primer set and a second master mix for Illumina_quant_Outer primer set.

A	B
COMPONENT	Volume (µl)
PowerUp SYBR Green Master Mix (2X)	5
10µM Forward primer	0.5
10µM Reverse primer	0.5
Diluted amplicon	2
Nuclease-Free Water	2

qPCR master mix Aliquot 8µL to each well and add in 2µL of the diluted amplicon.

A	B	C	D	E
Step	Temp (C)	Time (s)	Cycles	Ramp Rate (C/s)
UDG activation	50	120	1	2.73
Denaturation	95	120	1	2.73
Denaturation	95	1		2.73
Amplification	60	30		2.11
Capture	60	0	–
Melt Curve	95	1	1	2.73
	60	20	1	2.11
	95	–	1	0.15
	Capture	–	1	–

Cycle parameters for QuantStudio 3

The ratio of the Illumina _quant_Inner primer set to the Illumina _quant_Outer primer set will give the proportion of the DNA in the tube that contain both Illumina adapters and is sequencable (use this for pooling). While the melt curve will provide information on the proportion of each amplicon in the sample.

The amount of amplicon to be pooled and loaded can be calculated using the Illumina Sequencing Coverage Calculator by selecting DNA input then custom content and

depends on numerous factors, including the amplicon size and number, and the kit and device used. An example output is shown below.

A	B
Application or product:	Custom Content
Genome or region size (Mbases)	0.001
Read length	600
On target (%)	95
Coverage (x)	50000
Duplicates (%)	0
Instrument	MiSeq
Run type	v3 Reagents
Clusters	25,000,000 per flow cell
Output per unit (flow cell or lane)	15,000,000,000 per flow cell
Exceeds maximum read length?	Does not exceed maximum (2x300)
Number of units per sample (flow cell or lane)	0.004 flow cells
Samples per unit (flow cell or lane)	285/flow cell Most Illumina library prep kits enable up to 96 indexes; Nextera XT up to 384 indexes.
Comments	Upgraded software; MCS v2.3 or later; MiSeq Reagent Kit v3 (150/600)
Product	MiSeq Reagent Kit v3
Link	http://www.illumina.com/products/miseq-reagent-kit-v3.html

Illumina coverage estimator output.

The sequence data can be performed using most amplicon processing pipelines; however, the primer sequences must be trimmed from the reads to eliminate their effect on mutation identification. We have developed a pipeline to process data which is available at hissPCR analysis with further details, below is its basic usage command.

bash hissPCR.sh \
--R1 "test_data/read_R1_001.fastq.gz" \
--R2 "test_data/read_R2_001.fastq.gz" \
--ref "refs/BDQ_duplex.fasta" \
--primers "refs/primers.bed" \