Rapid and robust cloning of sgRNA expression plasmids

Order TOP and BOTTOM strand oligos, where the TOP sequence is the desired 20 nt sgRNA 'spacer' sequence and the BOTTOM sequence is the reverse complement of the TOP strand. After annealing of both oligos, the 5' overhangs should result in compatible sticky ends for T4 ligation into the target vector. Shown are example sticky ends to clone into the vector sgLenti (Addgene #105996). Alternative sgRNA expression vectors may require different sticky ends.

5’- TTGG NNNNNNNNNNNNNNNNNNN -3’ 3’-NNNNNNNNNNNNNNNNNNN CAAA -5’ TOP strand oligo: 5'- TTGG NNNNNNNNNNNNNNNNNNN-3' BOTTOM strand oligo: 5'- AAAC NNNNNNNNNNNNNNNNNNN-3'

Set up the annealing reaction: 1µL Top strand oligo100micromolar (µM)

1µL Bottom strand oligo 100micromolar (µM)

1µL

7µL ddH2O

Anneal oligos by running the following thermocycler program:

1. 95°C for 5 min

2. Ramp down at0.1°C from95°C to25°C

Set up AarI plasmid digest:

1µg vector for spCas9 sgRNA expression

2µL 10x AarI Buffer

1µL

0.4µL 50x Oligo

ddH2O to20µL

Incubate in a Thermocycler at 50°C

Prepare 1% Agarose gel

Add 4µL of 6x to 20µL of the restriction digestion mix.

Load samples on the 1% Agarose gel and run the electrophoresis at 120 V for 50 min

Place the gel in a UV light box

Cut the digested plasmid band from the gel and purify the DNA using the

Determine the concentration of the purified plasmid DNA (e.g. NanoDrop One)

Dilute the annealed oligos 1:200 in ddH2O

Set up the ligation reaction: 50ng purified vector

1µL diluted oligos 1µL 10x T4 Ligation buffer1µL

ddH2O 10µLo

Incubate for 10 min at Room temperature

Take DH5a chemocompetent cells from -80°C storage and thaw on ice for 30 min. Use 1 50µL aliquot for the ligation reaction and 1 50µL aliquot for the control reaction

Add 2µL of the T4 Ligation reaction and the control reaction to the cells and mix gently by flicking the tube

Incubate on ice for 30 min

Incubate the tube containing the cells in a water bath at 42°C for 45 sec and place back on ice for 2 min

Add 0.5mL of LB medium to the cells and incubate in a thermo-block at 37°C with shaking at 250 rpm for 1 hr

Plate 100µL of the cells on Room temperature LB agar plates with 100µg/mL Carbenicillin

Incubate at 37°C

After the overnight incubation, count the colonies on the ligation reaction and the control plates. The ligation reaction plate should have a minimum of 10x more colonies.

Seal the plates with parafilm and store at 4°C for up to 2 weeks

Pick up to 3 colonies from the plate using a pipette tip and inoculate 5mL LB medium with 100µg/mL Carbenicillin in 15 mL cell culture tubes

Incubate the cell culture tubes at 37°C and 225 rpm in a shaking incubator

Extract the plasmid DNA using the

Measure the concentration of the purified plasmid DNA (e.g. NanoDrop One)

Send the plasmids for Sanger sequencing with the following primer to confirm the correct sequence:

GGCTTGGATTTCTATAACTTCGTATAGCA