CRISPR knock-in (endogenous tagging)

For the C-terminus knock-in experiment, the sgRNAs and the homology-independent donor templates were generated

following strategies similar to those described previously

Briefly, the coding sequence of SNCA1 –the gene encoding α-syn at exon 6 was targeted by a sgRNA, and the oScarlet tag (a variant of mScarlet that is engineered to reduce

aggregation; a gift from Karl Deisseroth, Addgene plasmid #137135) was knocked

in using a homology-independent mechanism .

The donor sequence was designed following the SATI knock-in vector

with slight modifications for the intron knock-in experiment. Briefly, the

following sequences were directly conjugated as a donor tag; SNCA1 intron 4

(only the sequence after the gRNA targeting site), SNCA1 exon 5 (with wild type

or mutation sequences; S129A or S129D), SNCA1 exon 6 (coding site until stop

codon), 3X GGGGS linker, oScarlet (without a start codon and with a stop codon

at the end), and SNCA1 3’ UTR SNCA1 SNCA1 intron 4 was targeted by a

sgRNA (TTCTAAGTGTACCAAACCAC),

and the donor tag was homology-independently knocked in. The plasmid PX552

(RRID:Addgene_60958) (a

gift from Feng Zhang) was digested with a NotI restriction enzyme (New England

Biolabs, Cat#R3189L) and used as a plasmid backbone.

Oligonucleotides were ordered from Sigma. The genomic sequence of SNCA1

was partially synthesized by Twist Bioscience, and for the rest, it was PCR

amplified from a purified genome of a C57BL/6J mouse. DNA fragments were

ligated together using the In-Fusion Snap Assembly Master Mix (Takara, Cat# 638947) or DNA Ligation Kit Mighty Mix (Takara, Cat#6023). The sgRNA sequence for knock-in is listed in the supplemental materials. The AAV-SpCas9 plasmid PX551 RRID:Addgene_60957 (a gift from Feng Zhang) was modified by removing the HA tag.

Small-scale AAV cell lysates were produced

using the AAVpro Purification Kit (All Serotypes) (Takara, Cat# 6666) with slight

modifications. Briefly, HEK293T cells (RRID:CVCL_0063)

were triple transfected with the AAV targeting plasmid, helper plasmid (Agilent Technologies, Cat # 240071), and serotype PHP.S plasmid pUCmini-iCAP-PHP.eB (RRID:Addgene_103005)(a gift from Viviana Gradinaru) with PEI Max (Polysciences,

Cat#24765).

The medium was changed the next day of transfection, and cells were

incubated for 3 days after transfection. HEK cells were then collected and

lysed with the AAV Extraction Solution A plus.

The extracted solution was

centrifuged at 10,000 x g for 10 min to remove debris and mixed with Extraction

Solution B. This small-scale AAV solution was stored at -80 until use. For

viral transduction, hippocampal

neurons were plated at 60,000 cell²/cm2 density and infected 4 hours

later with 10ul of the AAVs expressing SpCas9 and sgRNAs/donor.

The media was replaced 2 days after infection. Before imaging or genomic analysis, the

transduced neurons were cultured to maturity (DIV-17-DIV-21).

For quantification of the knock-in α-syn:o-Scarlet fluorescence at synapses, images

were first background-corrected, small ROIs were manually placed over ~20-30

synapses on each image, and average intensities were calculated – all using

dropdown menus in MetaMorph Microscopy Automation and Image Analysis Software (RRID:SCR_00236 https://www.moleculardevices.com/products/cellular-imaging-systems/acquisition-and-analysis-software/metamorph-microscopy#gref) https://www.moleculardevices.com/products/cellular-imaging-systems/acquisition-and-analysis-software/metamorph-microscopy#grefref). The resulting datasets were

statistically analyzed using GraphPad Prism [(RRID:SCR_002798)

http://www.graphpad.com/].