Sanger sequencing of SARS-CoV-2 Spike protein
Tiago S. Salles*, Andrea Cony Cavalcanti*, Fabio Burack da Costa, Renata Campos Azevedo
Abstract
The SARS-CoV-2 responsible for the ongoing COVID pandemic reveals particular evolutionary dynamics and an extensive polymorphism, mainly in Spike protein. Monitoring the S protein mutations is crucial for successful controlling measures and detect variants that can evade vaccine immunity. Even after the costs reduction imposed by the pandemic, the new generation sequencing methodologies remain unavailable to many scientific groups. Therefore, to support the urgent surveillance of SARS-CoV-2 S protein, this work describes a protocol for complete nucleotide sequencing of the S protein using the Sanger technique. Thus, any laboratory with experience in sequencing can adopt this protocol.
Steps
RT-PCR
- Program the thermal cycler before setting up the reaction. The thermal cycler should be preheated to 45–60°C.
- Keep all components, reaction mixes, and samples on ice. After preparation of the samples, transfer them to the preheated thermal cycler and immediately start the RT–PCR program.
- Reaction mix should be prepared according to table 1.
| A | B | C |
|---|---|---|
| Component | Volume | Final concentration |
| 2X Reaction Mix | 12.5 μL | 1x |
| Sense primer (10 μM) | 1.75 μL | 0.7 μM |
| Anti-sense primer (10 μM) | 1.75 μL | 0.7 μM |
| SuperScript™ III RT/Platinum™ Taq High Fidelity Enzyme Mix[1] | 0.5 μL | |
| Template RNA | 5 μL | |
| Nuclease free water | to 25 μL |
Table 1 - RT-PCR master mix
- RT-PCR cycle is described below :
60°C 1 min |
50°C 45 min | Reverse Transcription | 1 cycle
94°C 2 min |
95 °C 15 s Denaturation |
53 °C 30 s Annealing | 40 cycles
68 °C 60 s Extension |
68 °C 7 min Final extention | 1 cycle
4 °C ∞
- Primers used : Position Melting temperature Size
P1 forward GTTTGTTTTTCTTGTTTTATT (21551-21574) 43.5 ºC 923bp
P1 reverse ACAGTGAAGGATTTCAACGTACAC (22450-22474) 55.3 ºC
P2 forward CGTGATCTCCCTCAGGGTTTT (22190-22211) 56.8 ºC 620bp
P2 reverse TCAGCAATCTTTCCAGTTTGCC (22810-22832) 56.1 ºC
P3 forward GTAATTAGAGGTGATGAAGTCAGA (22751-22775) 51.8 ºC 892bp
P3 reverse ACATAGTGTAGGCAATGATGGA (23621-23643) 53.6 ºC
P4 forward CTTGGCGTGTTTATTCTACAG (23445-23466) 51.4 ºC 979bp
P4 reverse GCTTGTGCATTTTGGTTGACC (24403-24424) 55.6 ºC
P5 forward AGACTCACTTTCTTCCACAGCA (24355-24377) 56.1 ºC 342bp
P5 reverse AGATGATAGCCCTTTCCACA (24699-24719) 53.3 ºC
P6 forward TTCTGCTAATCTTGCTGCTACT (24610-24632) 54.0 ºC 766bp
P6 reverse GTTTATGTGTAATGTAATTTGACTCC (25348-25372) 50.7 ºC
P7 forward TAGAGAAAACAACAGAGTT (21492-21511) 45.6 ºC 712bp
P7 reverse TGAGGGAGATCACGCACTAA (22184-22204) 55.4 ºC
P8 forward TTCTGCTAATCTTGCTGCTACT (24610-24632) 54.0 ºC 825bp
P8 reverse CCTTGCTTCAAAGTTACAGTTCCA (25409-25433) 55.6 ºC
Agarose gel Electrophoresis
- Dissolve agarose in 1.X TAE Buffer (40 mM Tris-acetate, 1 mM EDTA) to a final concentration of 1.5% agarose.
- Heat the solution in a microwave and let it cool at room temperature.
- Apply the agarose gel to the casting tray with the appropriate well comb and let it solidify.
- Mix 5 µL of PCR product with 5µL of loading buffer and 1µL Blue Green Loading dye I (LGC Biotecnologia), apply it to the gel, and run the electrophoresis at 120V.
- Visualize the gel with UV Transilluminator
Preparing Samples for sequencing
- Sequencing procedures are performed according to BigDye™ Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) guidelines.
- Measure DNA Concentration with a nanodrop spectrophotometer
- Dilute template to 200 ng/µl with nuclease-free water
- Dilute primers to 1 µM with nuclease-free water. Only one primer is used for each sequencing reaction, leading to two reactions per sample. Each reaction will need 1µl of diluted primer.
- Label and ship the samples and primers according to the sequencing service provider guidelines.
sequencing reaction:
- BigDye™ Terminator 3.1 Ready Reaction Mix - 8 µL
- primer (1 µM) - 6.4 µL
- Template (200ng) - 2 µL
- Deionized water (RNase/DNase-free) to - 20 µL
sequencing cycle:
96°C 1 min Incubation | 1 cycle
96 °C 10 s Denaturation |
50 °C 05 s Annealing | 25 cycles
60 °C 4 min Extension |
4 °C ∞ | 1 cycle
Sequence analysis
- Upon receiving the electropherograms, edit them with proper programs like chromas or Bioedit.
- For better editing accuracy, align the forward sequence with the reverse complement of the reverse sequence.
- Use BLAST search to confirm if the sequenced product corresponds to the desired target.
- Create contigs by aligning the planned overlaps between each target fragment and form one consensus sequence covering the full ORF of SARS-CoV-2 Spike protein
- Edited sequences can now be analyzed with the CoVsurver mutations app, provided by GISAID, to trace the mutation patterns of each sample and study their effects on protein structure.
- Sequences can also be deposited in the GISAID database of SARS-CoV-2.