Modified EMP ITS Illumina Amplicon Protocol
Dylan P. Smith, Kabir G. Peay, Gail Ackermann, Amy Apprill, Markus Bauer, Donna Berg-Lyons, Jason Betley, T. D. Bruns, J. Greg Caporaso, Noah Fierer, Louise Fraser, Jed A. Fuhrman, M. Gardes, Jack A. Gilbert, Niall Gormley, Greg Humphrey, James Huntley, Janet K. Jansson, Rob Knight, Chris L. Lauber, S. Lee, Sarah M. Owens, Alma E. Parada, Geoff Smith, J. Taylor, Luke Thompson, Willam A. Walters, T. J. White
Abstract
The ITS protocol detailed here is designed to amplify fungal microbial eukaryotic lineages using paired-end community sequencing on the Illumina platform with primers ITS1f-ITS2 (EMP.ITSkabir).
Note: This a modified version used in biocrust project at University of California Riverside.
Before start
For running these libraries on the MiSeq and HiSeq, please make sure you read the supplementary methods of Caporaso et al. (2012). You will need to make your sample more complex by adding 5-10% PhiX to your run.
Steps
Amplification Protocol
Amplify samples in triplicate.
Pool triplicate PCR reactions for each sample into a single volume (75 µL). Do not combine amplicons from different samples at this point.
Run amplicons from each sample on an agarose gel.
Quantify amplicons (DNA concentration) with NanoDrop spectrophotometer.
Clean up the amplicons using magnetic bead clean up. Please contact Matthew Collin matthew.collin@ucr.edu for the bead clean up protocol.
Combine an equal amount of amplicon from each sample (240 ng) into a single, sterile tube. Higher amounts can be used if the final pool will be gel-isolated or when working with low-biomass samples.
Measure concentration and A260/A280 ratio of final pool that has been cleaned.
Send an aliquot for sequencing along with sequencing primers listed below.
ITS sequencing primersRead 1 sequencing primerField descriptions (space-delimited):
- Forward primer segment
- Extended region into amplicon
TTGGTCATTTAGAGGAAGTAA AAGTCGTAACAAGGTTTCC
Read 2 sequencing primerField descriptions (space-delimited):
- Reverse primer segment
- Extended region into amplicon
CGTTCTTCATCGATGC VAGARCCAAGAGATC
Index sequencing primer1. Reverse complement of extended amplicon region
- Reverse complement of reverse primer
- Reverse complement of linker
TCTC GCATCGATGAAGAACGCAGC CG
