FLOUR-seq

The mouse testis were dissociated to single cells refer to Adult mouse testis cell dissociation (on ice).

Prime and treat the BD Rhapsody Cartridge (Cat. No. 400000847).

A	B	C	D	E
Step	Regent to load	Volume (μL)	P1200M pipette mode	Incubation at room temp.
1	100% ethyl alcohol	700	Prime/Treat	-
2	Air	700	Prime/Treat	-
3	Room temp. Cartridge Wash Buffer 1 (Cat. No. 650000060)	700	Prime/Treat	1min
4	Air	700	Prime/Treat	-
5	Room temp. Cartridge Wash Buffer 1 (Cat. No. 650000060)	700	Prime/Treat	10min
6	Air	700	Prime/Treat	-
7	Room temp. Cartridge Wash Buffer 2 (Cat. No. 650000061)	700	Prime/Treat	<4h

Dilute 20000 cells with cold Sample Buffer (Cat. No. 650000062) to 650 μL.

Load cartridge with materials listed using the P1200M pipette:

A	B	C
Material to load	Volume (μL)	Pipette mode
Air	700	Prime/Treat
􏰀Set P1200M pipette to Cell Load mode. 􏰀Pipet-mix the cell suspension with a manual P1000 pipette.
Cell suspension	575	Cell Load

Incubate at room temperature (15°C to 25°C) for 15 minutes. During 15 minute incubation, prepare Cell Capture Beads (Cat. No. 650000089) .

Place Cell Capture Bead tube on magnet for 1 minute, and remove storage buffer.

Remove tube from magnet, and pipet 650 μL cold Sample Buffer (Cat. No. 650000062) into tube.

Set P1200M pipette to P rime/Treat mode. Load cartridge with materials listed using the P1200M pipette:

A	B	C
Material to load	Volume (μL)	Pipette mode
Air	700	Prime/Treat
Set P1200M pipette to Bead Load mode. Use a manual P1000 to gently pipet-mix beads in cold Sample Buffer (Cat. No. 650000062). Immediately load.
Cell Capture Beads	630	Bead Load

Incubate the cartridge at room temperature (15°C to 25°C) for 3 minutes.

Place cartridge on the plate shaker plate adapter. Shake the cartridge at room temperature (15°C to 25°C) at 1,000 rpm for 15 seconds.

Return cartridge to Express instrument, and wait 30 seconds.

Set P1200M pipette to Wash mode. Load cartridge with materials listed using the P1200M pipette:

A	B	C
Material to load	Volume (μL)	Pipette modea
Air	700	Wash
Cold Sample Buffer (Cat. No. 650000062)	700	Wash
Air	700	Wash
Cold Sample Buffer (Cat. No. 650000062)	700	Wash

Add 75.0 μL 1 M DTT (Cat. No. 650000063) to one 15 mL Lysis Buffer bottle (Cat. No. 650000064). Briefly vortex lysis mix, place on ice.

Move the left slider to LYSIS on Express instrument. Set P1200M pipette to Lysis mode. Set P1200M pipette to Lysis mode.

A	B	C
Material to load	Volume (μL)	Pipette mode
Lysis Buffer with DTT	550	Lysis

Incubate at room temperature (15°C to 25°C) for 2 minutes.

Place the 5 mL LoBind Tube in Express instrument drawer. Ensure P5000M pipette is set to Retrieval mode. Move the front slider to BEADS on Express instrument.

Move the left slider to RETRIEVAL . Leave Retrieval magnet in down position for 30 seconds. Aspirate 5,000 μL Lysis Buffer with DTT with the P5000M pipette. Press down on P5000M pipette to seal against the gasket. Move the left slider to the middle position ( 0 ), andimmediatelyload 4,950 μL Lysis Buffer with DTT.

Remove pipette from gasket, and purge tip. Move the front slider to OPEN , and place the 5 mL LoBind Tube on large magnet with 15 mL tube adapter (V&P Scientific Cat. No. VP 772FB-1A) for 1 minute.

After 1 minute incubation leaving the 5 mL tube containing retrieved Cell Capture Beads on large magnet, remove all but ~1 mL of supernatant without disturbing beads.

Remove tube from magnet. Gently pipet-mix beads, and transfer them to a new 1.5 mL LoBind Tube.

Place tube on magnet for ≤2 minutes, and remove supernatant. Avoid leaving Lysis Buffer or bubbles in tube. Lysis Buffer might cause the reverse transcription reaction to fail.

Remove tube from magnet and pipet 1.0 mL of cold Bead Wash Buffer (Cat. No. 650000065) into tube. Pipet-mix.

Place tube on 1.5 mL tube magnet for ≤2 minutes, and remove supernatant.

Remove tube from magnet, and pipet 1.0 mL cold Bead Wash Buffer (Cat. No. 650000065) into tube. Pipet-mix, and place on ice.

In a new 1.5-mL LoBind tube, pipet the following reagents. cDNA/Template switching mix x

A	B
Component	Volume (μL)
RT Buffer	40
dNTP	20
RT 0.1 M DTT	10
Bead RT/PCR Enhancer	12
RNase Inhibitor	10
Reverse Transcriptase	10
Nuclease-free water	92
Total	194

Gently vortex mix, briefly centrifuge, and place back on ice.

Place the tube of washed Cell Capture Beads on a 1.5-mL tube magnet for≥2 minutes. Remove the

supernatant and pipet 194 μL of cDNA mix into the beads. Pipet-mix.

Incubate the bead suspension on the thermomixer at 1,200 rpm and 42°C for 30 minutes.

Place tube on 1.5 mL tube magnet for ≤2 minutes, and pipet supernatant to a new tube. Remove tube from magnet, and pipet 200 μL the following reagents into tube.

A	B
Component	Volume (μL)
10x Exonuclease I reaction buffer (BD Express, Cat. No. 650000071)	20
Exonuclease I (BD Express, Cat. No. 650000072)	10
Nuclease-free water	170

Place tube on 1.5 mL tube magnet for ≤2 minutes, and remove supernatant. Wash the beads twice with 1x RT buffer.

Resuspend the beads with the saved supernatant in step 25, add 3 μL of template switch oligo (100 uM5' A AGC AGT GGT ATC AAC GCA GAG TAC rG rG +G 3') , and incubate on the thermomixer for 15 minutes at 1,200 rpm and 42°C. Add 2 μL of 1 M MgCl2 to the reaction mix, and incubate on the thermomixer for another 15 minutes at 1,200 rpm and 42°C.

Briefly spin the tube with the bead suspension. Place the tube on the magnet for≤1 minute until clear. Remove the supernatant.

Remove the tube from the magnet, and pipet 200 μL of cold Bead Resuspension Buffer into the tube. Pipet- mix.

Place the tube beads in Bead Resuspension Buffer on a 1.5-mL magnet for≤1 minute. Remove the supernatant. Suspend the beads with following PCR reaction mix:

A	B	C
Component	Volume (μl )	Final Conc
KAPA HiFi HotStart 2x ReadyMix	100	1x
Universal Oligo (BD Express, 650000074)	6	0.3 μM
TSO PCR primer (10μM)	6	0.3μM
Nuclease-free water	up to 200μl

Universal Oligo: 5’-ACACGACGCTCTTCCGATCT-3'

TSO PCR primer: 5‘-AAGCAGTGGTATCAACGCAGAGTAC-3'

Ensuring that the beads are fully resuspended, pipet 25 μL of PCR reaction mix with beads into each of 8 0.2-mL PCR tubes.

Program the thermal cycler as follows.

A	B	C	D
Step	Cycles	Temperature	Time
Hot start	1	95°C	3 min
Denaturation	11	98°C	20 s
Annealing		62°C	3 min
Extension		72°C	4 min
Final extension	1	72°C	2 min
Hold	1	4°C	∞

Pipet-mix and combine the four reactions into a new 1.5-mL LoBind tube. Place the 1.5-mL tube on the magnet for≤1 minute. Pipet the supernatant into the new 1.5-mL LoBind tube without disturbing the beads.

Purify the amplified products by 0.7x Agencourt AMPure XP Beads(Beckman Coulter).

Prepare the PCR mix by combining and mixing the following components:

A	B	C
Component	Volume (μl )	Final Conc
KAPA HiFi HotStart 2x ReadyMix	500	1x
Library Forward Primer (BD Express,91-1085)	3	0.3 μM
TSO lengthen primer (10μM)	3	0.3μM
PCR1 product (50ng)
Nuclease-free water	up to 100μl

TSO lengthen primer: 5'-CGACATGGCTACGATCCGACAAGCAGTGGTATCAACGCAGAG-3'

Library Forward primer: 5'- AATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3'

Program the thermal cycler as follows.

A	B	C	D
Step	Cycles	Temperature	Time
Hot start	1	95°C	2 min
Denaturation	5	98°C	20 s
Annealing		62°C	20 s
Extension		72°C	4 min
Final extension	1	72°C	2 min
Hold	1	4°C	∞

Purify the amplified products by 0.7x Agencourt AMPure XP Beads(Beckman Coulter).

Prepared sequencing using Oxford Nanopore Technologies SQK-LSK109 and sequenced on ONT PromethION platforms.