Universal Competition Assay by Nanopore Sequencing (U-CAN-Seq)

Plate cells

Plate Vero81 cells in six 6-well plates at 2*10^5 cells/well 24 hours

Infect cells

Count cells by trypsinizing 1 well in 400 µl 0.05% trypsin-EDTA, putting in the incubator until cells detach, adding 600 µl of medium and resuspending.  Mix 10 µl of cell mixture with 10 µl of trypan blue and count with a hemocytometer.

# cells/#squares counted x 2 dilution factor x 10^4 = #cells/ml = #cells/well.

Calculate your inocula such that for each condition you have 3 ml of inoculum total.  You want to inoculate with 400 µl/well, at an MOI = 0.01 total.  (For example, for a 1:1 ratio, WT MOI= 0.005 and mutant MOI=0.005.)  Make inocula forthe following conditions:

WT only

Mutant only

WT: Mutant 1:1

WT: Mutant 5:1

WT: Mutant 10:1

Remove media from cells and infect 5 wells of each condition by adding 400 µl of inoculum. Return the plate to the incubator and return every 15 minutes for 1 hour to rock the plates to ensure even

distribution of infectious particles. Once 1 hour has passed, add 3mL of medium to each well.

*NOTE:  You only have to do one well each of WT only, mutant only, and mock.  They are controls that will not be used statistically.  These wells act as a control to ensure that cross-contamination has not occurred.

While the plates are rocking, harvest the leftover inoculum by moving 300 µl of each inoculum to 3 tubes with 900 µl of Trizol-LS reagent. Freeze overnight.

Harvest supernatant 24 hrs post infection, harvest each well once by taking 300 μl of supernatant and putting in a tube with 900 μl Trizol-LS reagent. Let incubate at least 10 min at room temp. Proceed or freeze at -20 for up to 1 month, or at -80 for up to a year, or proceed directly to RNA extraction.

Add 240 μl of chloroform to each tube with Trizol-LS and supernatant. Mix the tubes by shaking/vortexing and incubate 2-3 minutes at room temp and then spin 15 min 12,000g 4°C.

Move the aqueous phase to a new tube with 1 μl of glycogen or glycol-blue co- precipitant. Add 0.6 ml isopropanol and vortex or shake to mix. Incubate overnight at - 20.

NOTE: Do not do overnight at -80°C.

Spin 10 min 12000g 4°C to precipitate. You should see a pellet in the tube.

Remove the supernatant and wash with 1.2 ml 75% ethanol, vortexing to dislodge the pellet.

NOTE: You can pause here and freeze at -80°C indefinitely.

Spin again at 7500g 4°C, and remove the supernatant.

NOTE: Sometimes it can be hard to really get all the ethanol off, especially if some clings to the walls of the tube. If so, you can remove most of the ethanol, pop spin the tube for a few seconds to bring ethanol down, and then remove the rest of the ethanol with a small pipette.

Let the pellets air dry until slightly translucent. Then resuspend the pellet in 12 μl water by pipetting to mix, put at 55°C for ten minutes, return to ice, pipette to mix, and nanodrop.

Proceed, or freeze RNA at -80.

Reverse transcription Use the Superscript III kit to perform reverse transcription using a gene-specific primer. Use 8 μl of RNA from the purification in a superscript III RT reaction as described in the manufacturer’s protocol, except let the reaction run for 3 hrs instead of 1 hr.

Mix RNA, primer, and dNTPs. Heat mix 1 to 65°C five min, return to ice at least 1 min.

A	B
Mix 1	1x
Reverse primer 2 µM	1
10 mM dNTP	1
RNA	8

Add 10 µl mix 2/tube, heat to 50 °C 3 hrs, inactivate 85°C 5 min, infinite hold at 12°C. Proceed to PCR or freeze at -20.

A	B
Mix 2	1x
10x RT buffer	2
25 mM MgCl2	4
RNAse out	1
0.1 M DTT	2
Superscript III	1

PCR: Use 1 μl of each RT reaction as a template, regardless of concentration, to amplify the genome region in which your two genotypes of virus differ. Below is an example PCR protocol, but you will need to optimize your PCR conditions for your specific primers. Always include a no-template control and positive control (plasmid containing the sequence of interest.) When you are optimizing new primers, it may also be useful to isolate RNA from one set of mock-infected supernatant to use as another negative control.

A	B
	1x
GC buffer	4
10 mM dNTP	.4
Primer 1 10 µM	1
Primer 2 10 µM	1
DMSO	1
Template	1
Water	11.4
Phusion	0.2

Lid:  105°C

Volume:  20 µl

1. 95°C, 3:00
2. 95°C, 0:30
3. 56°C, 0:30
4. 72°C, 3:00
5. GOTO step 2, 34x
6. 72°C, 5:00
7. 12°C, infinite hold

Run a gel: Add 4 µl of 6x loading buffer to each sample and load 4 µl of the mixture on a 1% agarose gel.  Run for 1 hr at an appropriate voltage for your gel rig.  Stain in EtBr to visualize bands.  You should see a band at your target size.

Analyze results: search for k-mer exact match

Use grep search in terminal to search forstrings.  Use the following example code:

for file in /Users/jenloome/Desktop/Desktop_Jennifer’s_MacBook_Air/Notebooks_and_backups/0148_AV_Competition_assay_growth_curve_structure_scr_3/Loome_p9g_raw_reads/*.fastq; do { echo "(grep -o "ACGTGGACATAGACGCTGACAGCGCCTTTTT" "(grep -o "ATGTAGACATAGACGCTGACAGCGCCTTTCT" "$file" | wc -l); } >> 0148_AV_scrSL3_output.csv; done

Edit the following:

-Directory where your fastq files are at (on mac is probably /User/UserName/Downloads/PlasmidsourausRawReadDirectory/*.fastq), can be found in terminal by typing “pwd” while in that directory

-Name of string one (appears in the .csv file)

-First k-mer string that you are searching for

-Name of string two (appears in the .csv file)

-Second k-mer string that you are searching for

Alternative analysis method: Search for k-mer tolerating mismatch.  

The code below functions as above to search for k-mers of interest, counting both exact matches and matches that tolerate a single nucleotide mismatch.  This analysis method could be advantageous to improve read count but disadvantageous by introducing noise to the data.  In our hands, both methods of analysis have yielded similar results

#UNIX CODE

#output CSV file with the following columns

echo "File,Count_Exact_String,Count_1_Mismatch_String" > Name_of_output.csv

#directory containing .fastq files to be searched

directory="/example/directory/fastqfiles"

# nucleotide string to search for

string="NucleotideString"

#Loop through each .fastq file in the directory

for file in "$directory"/*.fastq; do

    # Extract the filename from the path

    filename=file")

    # find occurrences of the string with up to 1 mismatch and count both

    extracted_strings=string" 'BEGIN{RS="@";ORS=""}

        {

            # Check if the exact string is found

            i=index($2, pattern)

            if (i) {

                count_exact++

            } else {

                # Check for up to 1 mismatch

                for (j=1; j<=length(pattern); j++) {

                    if (substr($2, j, 1) != substr(pattern, j, 1)) {

                        if (++mismatches > 1) break

                    }

                }

                if (mismatches <= 1) {

                    count_mismatch++

                }

            }

            mismatches=0

        }

        END {

            # Print the counts as CSV

            print count_exact "," count_mismatch ","

        }' "$file")

    # output counts to the CSV (same file as above)

    echo "extracted_strings" >> Name_of_output.csv

done