Nano-CUT&Tag for multimodal profiling of the chromatin

Marek Bartosovic, Goncalo Castelo-Branco

Published: 2022-06-28 DOI: 10.17504/protocols.io.8epv59o8dg1b/v1

Disclaimer

This protocol includes portions that are excerpted from works © 2018-2022 10x Genomics, Inc. (10x Genomics) and reproduced here with permission. All other rights reserved. The use of 10x Genomics products in practicing the methods set forth herein has not been validated by 10x Genomics, and such non-validated use is not covered by 10x Genomics’ standard warranty, and 10X GENOMICS HEREBY DISCLAIMS ANY AND ALL WARRANTIES FOR SUCH USE. Nothing in this document should be construed as altering, waiving or amending in any manner 10x Genomics’ terms and conditions of sale or use for its products and software, including without limitation such terms and conditions relating to certain use restrictions, limited license, warranty and limitation of liability, and nothing in this document shall be deemed to be Documentation, as that term is set forth in such terms and conditions of sale. Nothing in this document shall be construed as any representation by 10x Genomics that it currently or will at any time in the future offer or in any way support any application set forth herein.

Abstract

Nano-CUT&Tag is a multimodal technology to profile several histone modifications at the same with single-cell resolution. Nano-CUT&Tag implements a novel Tn5 fusion proteins to anti-mouse and anti-rabbit secondary nanobodies. Optionally, ATAC-seq can be performed prior on the same sample to profile open chromatin at the same time. Novel tagmentation protocol, which involves two-step tagmentation by MeA and MeB oligonucleotides yields increased number of fragments per cell comparing to previous single-cell CUT&Tag protocols on 10x Genomics platform.

Figure 1. Comparison of scCUT&Tag and nano-CT tagmentation protocol

Figure 2. Depiction of the new tagmentation strategy of nano-CT. First nuclei are tagmented by nano-Tn5 loaded with MeA oligonucleotides. After single-cell barcoding and DNA recovery/purification, it is tagmented randomly with standard Tn5 loaded with MeB oligonucleotides.

Figure 3. Number of fragments per cell in nano-CT comparing to single-cell CUT&Tag

Figure 4. Multimodal UMAP projection of 3 epigenetic modalities measured in the mouse brain

Before start

Before starting, make yourself familiar with the 10x genomics Chromium Single Cell ATAC Reagent Kits User Guide (v1.1 Chemistry).

Follow all the best practices and tips given in the 10x genomics Chromium Single Cell ATAC Reagent Kits User Guide.

This protocol is compatible with Chromium Next GEM Single Cell ATAC Library & Gel Bead Kit v1.1 has not been tested with Chromium Next GEM Single Cell ATAC Kit v2.

CG000209_Chromium_NextGEM_SingleCell_ATAC_ReagentKits_v1.1_UserGuide_RevF.pdf

Steps

Tn5 loading

Annealing adaptor sequences:

Tn5_MeA_P5_noBCD.

5' TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG

Tn5_MeA_P5_bcdA.

5'-TCGTCGGCAGCGTCT TATAGCCT GCGATCGAGGACGGCAGATGTGTATAAGAGACAG

Tn5_MeA_P5_bcdB

5'-TCGTCGGCAGCGTCT ATAGAGGC GCGATCGAGGACGGCAGATGTGTATAAGAGACAG

Tn5_MeA_P5_bcdC

5'-TCGTCGGCAGCGTCT CCTATCCT GCGATCGAGGACGGCAGATGTGTATAAGAGACAG

Tn5ME-B:

5′- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3′

Tn5MErev.

5'-[phos]CTGTCTCTTATACACATCT-3'

Note

Nano-CUT&Tag can be performed in its barcoded (multimodal) and unbarcoded version (single histone modality)

Note

Optionally, extra nucleotides can be included to prevent low complexity in sequencing of adaptor part of the library, if using sequencing platform sensitive to low complexity regions. Equimolar ratio of the 4 following oligonucleotides shoul then be used. For example for barcode A:>Tn5_P5_MeA_BcdA_0N TCGTCGGCAGCGTCTCCACGCTATAGCCTGCGATCGAGGACGGCAGATGTGTATAAGAGACAG>Tn5_P5_MeA_BcdA_1N TCGTCGGCAGCGTCTCCACGCTATAGCCTNGCGATCGAGGACGGCAGATGTGTATAAGAGACAG>Tn5_P5_MeA_BcdA_2N TCGTCGGCAGCGTCTCCACGCTATAGCCTNNGCGATCGAGGACGGCAGATGTGTATAAGAGACAG>Tn5_P5_MeA_BcdA_3N TCGTCGGCAGCGTCTCCACGCTATAGCCTNNNGCGATCGAGGACGGCAGATGTGTATAAGAGACAGThis should not be necessary for NovaSeq and HiSeq platforms, but sequence on your own risk.

Resuspend the oligonucleotides (Tn5ME-A, Tn5ME-B, Tn5MErev) in water to a final concentration of 100µM each.

Mix equimolar amounts of Tn5MErev/Tn5ME-A and Tn5MErev/Tn5ME-B in separate 200 µl PCR tubes.

e.g:

tube1: 10µL Tn5ME-A + 10µL Tn5MErev

tube2: 10µL Tn5ME-B + 10µL Tn5MErev

Denature in the thermocycler for 0h 5m 0s at 95°C , and cool down slowly on the thermocycler by ramping down to 20°C by 0.1°C

Pause point: Store the annealed oligos at -20°C

Mix annealing mix.

The final Tn5 concentration is 2micromolar (µM) of Tn5 dimer

Use unique barcodes for specific nano-Tn5 or WT-Tn5.

Mouse Nano-Tn5 (MeA/P5 loaded):

4µL Annealed, barcoded MeA/Me-Rev oligos 50micromolar (µM) (e.g. barcode A, Me-A/Me-Rev)

21µL Glycerol

3µL Nano-Tn5 (mouse, 5mg/ml, MW = 73941 g/mol; 67.6micromolar (µM) )

22µL 2x Tn5 loading buffer

Rabbit Nano-Tn5 (MeA/P5 loaded):

4µL Annealed, barcoded MeA/Me-Rev oligos 50micromolar (µM) (e.g. barcode B, Me-A/Me-Rev)

21µL Glycerol

2.2µL Nano-Tn5 (rabbit, 6.8mg/ml, MW = 73013 g/mol 93.1micromolar (µM) )

22.8µL 2x 2x Tn5 loading buffer

WT Tn5-MeA with barcode (for ATAC-seq)

4µL Annealed, barcoded MeA/Me-Rev oligos 50micromolar (µM) (e.g. barcode C, Me-A/Me-Rev)

21µL Glycerol

3.1µL Tn5 (3.5 mg/ml, MW = 53300 g/mol 65.7micromolar (µM) )

21.9µL 2x 2x Tn5 loading buffer

WT Tn5-MeB unbarcoded (for 2nd tagmentation)

4µL Annealed MeB/Me-Rev oligos 50micromolar (µM) (un-barcoded, Me-B/Me-Rev)

21µL Glycerol

3.1µL Tn5 (3.5 mg/ml, MW = 53300 g/mol 65.7micromolar (µM) )

21.9µL 2x Tn5 loading buffer

Note

Adjust the volumes for specific nano-Tn5 protein batch for final 2micromolar (µM) nano-Tn5 dimer. The volume of nano-Tn5 and 2x Tn5 loading buffer should add up to 25µL and volume of oligos and glycerol also adds up to 25µL.Optionally scale up or down the reactions as necessary.

2x Dialysis buffer

100 mM HEPES-KOH pH7.2, 200 mM NaCl, 0.2 mM EDTA, 0.2% Triton-X, 20% Glycerol, Store at 4°C ;

Add DTT fresh to the 2x dialysis buffer just before loading (2mM final). Keep 200 mM DTT stock at -20°C

For details on buffer preparation see Materials section

Incubate for 1h 0m 0s at Room temperature

Store the loaded nano-Tn5 at -20°C

ATAC-seq (optional)

Dissociate tissues/cells of interest by desired method and obtain single-cell suspension. Wash the cells once with 1x PBS

Note

ATAC-seq protocol is based on the Omni-ATAC protocol (Corces et al., 2017).

Centrifuge the cells for 0h 10m 0s at 300x g at 4°C . Discard the supernatant.

10.

Add 200µL of ATAC lysis buffer (for 200,000 cells, see materials section for buffer recipe). Pipette up and down gently 3x and incubate on ice for 0h 3m 0s

Note

Scale the volume of lysis buffer down for lower cell input (e.g. 50ul for 50,000 cells)

11.

Add 1mL of ATAC wash buffer and gently invert the tube 3x.

12.

Centrifuge at 500x g for 0h 10m 0s . Discard the supernatant.

13.

Prepare transposition mix:

100µL 2X TD Buffer (see materials section) 66µL 1X PBS2µL 10% Tween-20 (final 0.1% v/v2µL

         1% Digitonin (final 0.01% v/`10µL`)

      Tn5 Transposase (loaded with uniquely barcoded oligonucleotides-MeA onl`20µL`) 

      nuclease-free H2O

14.

Resuspend the nuclei in 200µL of transposition mix (for 200,000 cells).

Note

Scale the volume of transposition mix down for lower cell input (e.g. 50ul for 50,000 cells)

15.

Incubate for 0h 30m 0s at 37°C in thermomixer at 1000 rpm.

16.

Stop the tagmentation by adding 10µL of 500 mM EDTA. Mix by pipetting up and down 3x.

17.

Centrifuge for 0h 10m 0s at 500x g

18.

Remove the supernatant. Resuspend in 200µL of CUT&Tag Antibody buffer.

19.

Centrifuge for 0h 3m 0s at 600x g. Remove the supernatant.

Proceed to CUT&Tag Antibody binding ( Step 23 ).

CUT&Tag Nuclei isolation (nano-CUT&Tag without ATAC)

20.

Dissociate tissues/cells of interest by desired method and extract nuclei by incubation for 0h 3m 0s in 200µL of Antibody buffer on ice.

Note

Amount of input material can range from 25,000 - 200,000, depending on tissue or cell type and whether ATAC-seq is performed together with nano-CUT&Tag

Note

If ATAC-seq is desired, good starting point is 200,000 cells.In case ATAC-seq is not done, good starting point is 100,000 cells.

21.

Centrifuge the nuclei for 0h 3m 0s at 600x g.

22.

Remove the supernatant.

Note

To prevent loss of nuclei, all centrifugations and incubations should be done in 0.5 ml micro-tubes. This makes it possible to see the nuclei better even for low input samples (e.g. 50,000 cells).All centrifugation steps should be performed in swinging bucket rotor centrifuge with the appropriate adaptors. When removing supernatant, it is ok to leave ~10ul of the supernatant in the tube, to prevent loss of nuclei.

Antibody binding

23.

Prepare antibody mix

Starting concentrations (can be further optimised, depending on the antibody)

1:100 primary antibody

1:100 nano-Tn5

Final volume 100ul per sample.

24.

Resuspend the nuclei pelet in the prepared antibody mix (1:100 primary antibody, 1:100 nano-Tn5) by pipetting up and down 5x.

25.

Incubate 0h 3m 0s on with rotation on a horizontal roller at 4°C

Note

Make sure the liquid does not reach the cap of the tube during the incubation, as nuclei can get stuck in the cap.

Washing and Tagmentation

26.

The next day, centrifuge for 0h 3m 0s at 600xg.

27.

Remove the supernatant and resuspend in 200 ul of Dig-300 wash buffer .

Note

Eject the buffer, with medium speed, so the pellet is dispersed, but do not pipette-mix (unless necessary, this might lead to loss of nuclei) or do not create excessive bubbles.

28.

Repeat the steps 27-28 for total of 2 washes.

29.

Resuspend the nuclei pellet in 200 ul of Tagmentation buffer. Pipette mix 5x to resuspend the pellet.

30.

Incubate for 1h 0m 0s at 37°C

Note

Pipette mix the nuclei ~30 minutes into the incubation to prevent sedimentation. If there is no suitable adapter for 0.5 ml tubes in the thermomixer, use 1.5ml eppendorf tubes with ~800ul of water as adapters or use water bath.

31.

During the incubation prepare tagmentation STOP buffer.

Prepare 2x diluted nuclei buffer (DNB) from 20x nuclei buffer (10x scATAC-seq, PN: 2000207). Store the aliquots of 2x DNB at -20°C

Stop buffer:

100µL 2x Diluted Nuclei buffer

20µL 20% BSA

70µL water

10µL 500 mM EDTA).

1x DNB + BSA buffer:

500µL 2x Diluted Nuclei buffer (10x scATAC-seq kit, dilute down from 20x (PN: 2000207))

100µL 20% BSA

400µL water

32.

Stop the tagmentation by removing from 37 thermoblock and adding 200µL of STOP buffer. Mix well by pipetting up and down 3x.

33.

Centrifuge for 0h 3m 0s at 300x g. Remove supernatant

34.

Resuspend the nuclei in 200µL of 1x DNB+BSA buffer.

35.

Centrifuge for 0h 3m 0s at 300x g. Remove supernatant

36.

Resuspend the nuclei in 200µL of 1x DNB+BSA buffer.

37.

Centrifuge for 0h 3m 0s at 300x g.

38.

Remove the most of the supernatant, leave the nuclei in cca 10µL of remaining 1xDNB+BSA buffer.

39.

Add 10µL of 1xDNB+BSA buffer, for final 20 ul of nuclei suspension. Measure the exact volume using P20 pipette.

Nuclei counting )

40.

Count the concentration of nuclei. Use 2µL of nuclei suspension and mix with 8µL of trypan blue. For counting use manual counting chambers (VWR, 630-1893). Do the counting in two replicates for more accuracy.

41.

To aim for cca 5,000 recovered nuclei, load cca 16,000 nuclei or determine ratio of loaded/recovered nuclei empirically.

Note

In our experience, the recovery of nuclei after 10x barcoding is lower, comparing to loading recommendations from 10x genomics for scATAC-seq. The ratio of loaded/recovered nuclei can vary based on specific biological sample and nuclei preparation.

Chromium Next GEM barcoding

42.

Note

The next part of the protocol follows closely theChromium Next GEM Single Cell ATAC Reagent Kits v1.1 Steps 2.0-2.5

Note

Make yourself familiar with the 10x Genomics scATAC-seq kit manual before proceeding.

CG000209_Chromium_NextGEM_SingleCell_ATAC_ReagentKits_v1.1_UserGuide_RevF.pdf

43.

Mix the GEM generation and barcoding mix. Use the desired volume of nuclei and fill up to 15µL with 1x DNB+BSA buffer.

Prepare nuclei mix and keep it on ice:

7µL ATAC buffer B

XµL Nuclei (Use =< 8ul of nuclei)

up to 15µL 1x DNB+BSA buffer

keep on ice

44.

Prepare barcoding mix and :

56.5µL Barcoding reagent B

1.5µL Reducing agent B

2µL Barcoding enzyme

keep it on ice

45.

Assemble the Chromium Next GEM Chip H according to the manufacturer's instructions.

46.

Load the Chromium Next GEM Chip H according to the manufacturer's instructions. Run the droplet generation.

47.

Recover droplets from the Next GEM Chip H according to the manufacturer's instructions.

48.

Incubate in PCR cycler according to the manufacturer's instructions.

The linear amplification (LA) and single-cell barcoding occurs at this step.

Barcoding and linear amplification temperature program.

Post-GEM incubation cleanup

49.

Perform post-GEM incubation cleanup according to manufacturer's instructions - Steps 3.1-3.2

50.

Use 2ul of the purified DNA to measure the concentration (optional) using Qubit high sensitivity dsDNA kit.

Note

We recommend measuring the DNA concentration at this stage, during optimisations experiments. The library is linearly amplified at this stage, so minor loss of sample is acceptable. Optimal ratio of LA barcoding product and MeB Tn5 is critical to achieve maximum complexity of the library. The DNA:Tn5 ratio can be optimised also in bulk experiments. Briefly:1. perform this protocol until step 33. 2. Resuspend the nuclei in 100ul of Dig-300 buffer. A3. Add 500ul of Zymo DNA clean and concentrator-5 binding buffer to the nuclei4. Purify the gDNA using the zymo DNA clean and concentrator-5 kit5. Elute DNA in 25 ul of elution buffer.6. Use ~5ul of eluted DNA for linear amplification reaction (5ul DNA, 2ul 10x_LA primer_noBCD, 25ul 2x NEBnext mastermix, 18 ul water)7. Run the program from 10x sATAC protocol - Step 2.5 GEM incubation (1. 72C 5min, 2. 98C 30s, 3. 98C 10s, 4. 59C 30s, 5. 72C 1min, 6. GOTO 3, 11x, 7. 15C hold infinite. )8. Purify the product using 1.2x SPRI beads. Elute in 25 ul of EB buffer. 9. Measure concentration of DNA. 10. Mix 10ng of DNA with varying amounts of MeB-Tn5 (0.05ul-2ul) in 1x TD buffer final11. incubate for 30 minutes at 37C12. Purify using Zymo DNA clean and concentrator-5 kit. use 1:5 ratio of binding buffer to the sample. Elute the DNA in 25 ul13. Use 10 ul of the eluted DNA for PCR (10 ul eluted DNA, 2ul PCR_FW primer 2ul Rev primer, 11ul water, 25ul 2x NEBnext MM). 14. Run PCR program as in step 53 PCR library amplification (1. 72C 5min, 2. 98C 45s, 3. 98C 20s, 4. 67C 30s, 5. 72C 20s, 6. GOTO 3, 7x, 7. 72C 1min, 8. 4C hold infinite. )15. Run Bioanalyser/Tapestation to identify the optimal Tn5-MeB ratio to DNA>10x_LA_primer_noBCDAATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC>PCR_FW_primerAATGATACGGCGACCACCGAGA,>PCR_Rev_primerCAAGCAGAAGACGGCATACGAGAT [8-bp sample index] GTCTCGTGGGCTCGG

Note

Optimal ratio of our home-made WT Tn5 is 0.7ul of MeB-Tn5 to 10ng of barcoded LA product. This ratio should be determined specifically for each batch of Tn5. Typical yield of multimodal nanoCT barcoded LA product is ~5-10 ng in our hands. Good starting point for optimisation of MeB Tn5 amount is 0.5µL for our Tn5 Commercial Tn5 enzymes (e.g. EZ-Tn5) can be more active than a typical homemade Tn5 and therefore might require higher dilution.

MeB tagmentation and library preparation

51.

Mix MeB tagmentation reaction:

38-40µL Barcoded LA product (from previous step, typically 5-10 ng)

50µL 2x TD buffer

0.5µL MeB-loaded Tn5 (starting point, should be adjusted for specific batch of Tn5 and yield of DNA)

up to 100µL Water

Incubate in PCR cycler 0h 30m 0s at 37°C -> 4°C hold

Heated lid at 50°C

52.

Purify the DNA using Zymo DNA Clean and concentrator-5 kit according to manufacturer's instructions.

Transfer the sample into 1.5 ml eppendorf tube.

Add 500µL of zymo binding buffer to your sample.

Wash 2x with 200µL of zymo wash buffer.

Perform one more dry spin 1min at max speed to remove residual liquid.

Elute the DNA in 40µL of DNA elution buffer (Zymo kit) . Incubate 2minutes on column, then centrifuge.

D4003T_D4003_D4004_D4013_D4014_DNA_Clean_Concentrator-5_ver_1_2_1_LKN-SW__1.pdf

53.

Run PCR library amplification:

40µL Purified DNA from previous step (sample)

7.5µL SI-PCR primer B (10x ATAC-seq kit; PN: 2000128)

2.5µL Individual Single Index N Set A primer (product code: 1000212)

50µL AMP mix (10x ATAC-seq kit; PN: 2000047/ 2000103)

Incubate in PCR cycler with the following program:

Lid temperature 105°C , volume 100µL .

72°C 5min
98°C 45sec
98°C 20sec |
67°C 30sec | Repeat 13x
72°C 20sec |
72°C 1min
4°C hold

Note

Typically we use 13 PCR cycles for library amplification, which is agood starting point, but the number of cycles should be adjusted according to typical yield for a specific combination of antibodies and input material. We typically aim for 10nM library in the range of 300-700bp

54.

Purify the final library using according to Step 4.2 in Chromium Next GEM Single Cell ATAC Reagent Kits v1.1.

Sequencing preparation

55.

Sequence on Illumina NovaSeq v1.5 platform with read setup : 36-8-48-36 (R1-I1-I2-R2) using custom sequencing primers:

Custom_primer_R1: GCGATCGAGGACGGCAGATGTGTATAAGAGACAG

Custom_primer_I2: CTGTCTCTTATACACATCTGCCGTCCTCGATCGC

R2 & I1 standard

56.

Library structure:

P5 side:

P7 side:

57.

We typically aim for ~25,000 read pairs per cell, meaning 125,000,000 reads for 5000 cells (~one 10x lane).

Desired outcome

58.

Typical bioanalyzer trace of a successful experiment shows good and even distribution of fragment sizes and is not overtagmented or undertagmented. Both over- and under- tagmenation will lead to reduced complexity of the library.