In vivo tissue-specific chromatin profiling in Drosophila

Homogenization/wash buffer

40 mM HEPES, pH 7.5

120 mM KCl

0.4% NP40 (IGEPAL)

Dilution buffer [cold]

40 mM HEPES, pH 7.5

120 mM KCl

Bead washing buffer [cold]

1X Phosphate Buffer Saline (PBS) buffer, pH 7.4

2.5 mM MgCl₂

0.02% Tween-20

## Omni-ATAC

Omni-ATAC tagmentation mix

25 µL 2X buffer

2.5 µL Tn5

16.5 µL PBS

0.5 µL 1% digitonin

0.5 µL 10% Tween-20

5 µL H₂O

## ChIP-seq

A1 buffer

15 mM HEPES

15 mM NaCl

60 mM KCl

4 mM MgCl₂

0.5% Triton X-100

Nuclei Lysis Buffer

50 mM Tris

10 mM EDTA

1% SDS

X-ChIP dilution buffer

16.7 mM Tris-HCl, pH 8.0

167 mM NaCl

1% Triton X-100

1.2 mM EDTA

X-ChIP elution buffer

100 mM NaHCO₃

1% SDS

Low Salt Buffer

20 mM Tris-HCl, pH 8.0

150 mM NaCl

0.1% SDS

1% Triton X-100

2 mM EDTA

High Salt Buffer

20 mM Tris-HCl, pH 8.0

500 mM NaCl

0.1% SDS

1% Triton X-100

2 mM EDTA

LiCl wash buffer

10 mM Tris-HCl, pH 8.0

250 mM LiCl

0.1% Na-Deoxycholate

0.1% NP-40 or IGEPAL

1 mM EDTA

TE buffer

10 mM Tris-HCl, pH 8.0

1 mM EDTA

## CUT&Tag

Wash 150 buffer

20 mM HEPES, pH 7.5

150 mM NaCl

0.5 mM Spermidine

1X Roche cOmplete^TM, Mini, EDTA-free protease inhibitor (1 tablet/10mL Wash150 buffer)

Store at 4C for up to 1 week

Digitonin150 buffer

Wash buffer + 0.01% Digitonin

Prepare fresh each day and store at 4C

Antibody150 buffer

Digitonin buffer + 2 mM EDTA

Prepare fresh each day and store at 4C

Wash300 buffer

20 mM HEPES, pH 7.5

300 mM NaCl

0.5 mM Spermidine

1X Roche cOmplete^TM, Mini, EDTA-free Protease Inhibitor (1 tablet/10 mL Wash300 buffer)

Store at 4C for up to 1 week

Digitonin300 buffer

Wash 300 Buffer + 0.01% Digitonin

Prepare fresh each day and store at 4C

Tagmentation buffer

Wash buffer + 10 mM MgCl₂

Store at 4C for up to 1 week

TAPS buffer

10 mM TAPS, pH 8.5

0.2 mM EDTA

Store at RT for up to 6 months

SDS Release Buffer

10 mM TAPS, pH 8.5

0.1% SDS

Store at RT for up to 6 months

SDS Quench Buffer

0.67% Triton-X 100 in Molecular grade H₂O

Store at RT for up 6 months

Primers:

Nextera P1: AATGATACGGCGACCACCGAGA

Nextera P2: CAAGCAGAAGACGGCATACGA

Universal i5: AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG

Indexed i7-1: CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGT

Indexed i7-2: CAAGCAGAAGACGGCATACGAGATCTAGTACGGTCTCGTGGGCTCGGAGATGT

Indexed i7-3: CAAGCAGAAGACGGCATACGAGATTTCTGCCTGTCTCGTGGGCTCGGAGATGT

Indexed i7-4: CAAGCAGAAGACGGCATACGAGATGCTCAGGAGTCTCGTGGGCTCGGAGATGT

Generate flies expressing GFP^KASH protein in the cell type of interest by crossing UAS-GFP^KASH or QUAS-GFP^KASH flies with the appropriate Gal4 or QF driver. Confirm expression patterns by microscopy. We typically generate recombinant flies expressing the driver and GFP^KASH where both transgenes are homozygous (two copies) because this is convenient for expanding the flies, and we have found that the IP efficiency improves with higher expression. However, we can also obtain nuclei from flies expressing only a single copy of the driver and GFP^KASH, even when combining these with other UAS-transgenes such as RNAi or overexpression.

Note: Note: The following amounts of Dynabeads and antibody are for 400 fly heads. These amounts can be scaled depending on input. 400 fly heads . These amounts can be scaled depending on input.

Incubate 20 μL/reaction of in 1 mL bead washing buffer for 10 min at RT with constant rotation.

Transfer tube to magnet stand and remove supernatant.

• For this step, and all steps involving the magnet - briefly spin tubes in a microcentrifuge to remove any liquid from the cap before placing tube on the magnet stand.
• We use a 1 mL pipettor to remove the supernatant at all bead/magnet steps.
• Wait at least 1 min to make sure all beads are cleared from solution before pipetting liquid out.

Resuspend beads in 1 mL bead washing buffer and add 2 μg .

Incubate at room temperature for 30 min with constant rotation.

Transfer tube to magnet and remove supernatant.

Resuspend beads in 100 μL 0.1% homogenization/wash buffer (mix 3 parts dilution buffer and 1 part homogenization/wash buffer for a final NP-40 concentration of 0.1%).

• The resuspension volume can be altered depending on how many samples are being processed. Aim for 50 μL/sample. E.g., if you are processing 4 samples for NIE, resuspend in 200 μL 0.1% homogenization/wash buffer.

Homogenization notes:

• Always keep homogenizer on ice
• Use 3 mL of homogenization buffer for any number up to 400 fly heads - from flies snap frozen in liquid nitrogen and stored at -80°C
• Fresh samples can also be used e.g., partially dissecting tissues from larvae, whole embryos - but nuclei can be isolated successfully from frozen flies and this is our standard approach for neuronal cell types in the adult head

Add 3 mL of homogenization/wash buffer and 100 μL 25X to a Dounce homogenizer. Keep on ice.

Transfer frozen flies into 15 mL conical tubes. Pre-chill the sieves, flies, and paint brush using liquid nitrogen.

Vortex conical tubes containing flies for 3 seconds, then place tubes back into liquid nitrogen. Repeat 4 more times to separate fly heads from bodies.

Keep sieves cold by pouring a small amount of liquid nitrogen over them between vortexing tubes.

Pour flies into pre-cooled top sieve and tap top sieve so fly heads fall into middle sieve. Remove top sieve and tap middle sieve to get rid of any smaller debris.

Transfer separated fly heads from middle sieve into 7 mL glass Dounce homogenizer using a paint brush chilled using liquid nitrogen.

Grind samples in Dounce homogenizer with 5 "loose" pestle strokes.

• Homogenize slowly, lifting pestle all the way out to the wide bulb each time
• Twisting the pestle in the bottom may improve homogenization

Incubate samples on ice for 1 min.

Grind samples with 5 "tight" pestle strokes.

Filter homogenate using 40 μm cell strainer or Miracloth and glass funnel into two microcentrifuge tubes.

If using Miracloth:

• Cut ends off 1000 μL pipette tips (one per sample) using scissors sterilized with Ethanol - tips are cut so fly heads can be pipetted easily
• Put small glass funnel into microcentrifuge tube
• Cut a square of Miracloth (large enough to fit into funnel and extend slightly over the sides) and place into funnel
• Pipette half of homogenate through the Miracloth and funnel into one microcentrifuge tube using cut tip (head debris will stay in Miracloth, while nuclei will pass through)
• Transfer funnel and Miracloth into second microcentrifuge tube, and pipette rest of homogenate into tube

Centrifuge homogenate at 800 x g for 5 min at 4°C.

Carefully decant supernatant containing cell debris and resuspend the two pellets from each sample in 0.5 mL 0.1% homogenization/wash buffer total, combining the two pellets into one microcentrifuge tube.

Pipette combined pellets up and down ~10 times, or until pellet is completely dispersed.

Add 20 μL 25X protease inhibitor to each tube.

Add 50 μL antibody-bound beads into each tube that has homogenate

Or, split antibody-bound beads evenly between all tubes depending on the resuspension volume.

Incubate nuclei and antibody-bound beads for 60 min at 4°C with constant rotation.

Remove supernatant using a magnet.

Gently resuspend bead-bound nuclei with 1 mL 0.1% homogenization/wash buffer .

Incubate for 5 min at 4$$°C with constant rotation.

Repeat wash steps 23-24 two more times.

After final wash, samples contain bead-bound GFP-expressing nuclei and can be used subsequently for RNA-seq, Omni-ATAC, ChIP-seq, CUT&Tag, or CUT&RUN.

Resuspend beads in and purify according to the manufacturers' instructions. We typically use Direct-Zol microprep kit, eluting in 15 μL, and quantify 2 μL of eluted RNA using

Libraries for RNA-seq can be generated using. This kit allows RNA inputs : [10 pg- 10 ng]. This library kit has ribodepletion step incorporated into the protocol using Drosophila anyDeplete, and libraries are therefore total nuclear RNA depleted for rRNA (not mRNA). We also recommend to use a library kit that has an in-solution DNAse step as part of the initial protocol because in our hands, the gDNA removal in the Direct-Zol kit is not 100% efficient.

Begin the Omni-ATAC protocol at this step using the bead-bound nuclei obtained in Step 22.

After third wash, resuspend nuclei in 500 μL homogenization/wash buffer

Quantify gDNA from 10% of nuclei suspension or count nuclei using hemocytometer. We typically determine gDNA using kit, and use this to determine the amount of nuclei suspension to use for Omni-ATAC. For comparisons between samples under different experimental conditions, the same amount of nuclei (DNA) should be used.

Based on quantification, aliquot nuclei according to desired input amount. We have successfully used 50 ng or 100 ng DNA equivalent for Omni-ATAC, but it is likely that much lower input DNA levels will also work well using this protocol.

Using magnet, remove supernatant and resuspend nuclei in 50 μL of Omni-ATAC tagmentation mix

Perform Omni-ATAC as described in this publication: (Corces, 2017)

Incubate reaction for 30 minutes at 37C in a thermal shaker using 1000 RPM shaking speed.

Purify DNA using and elute in 15 μL elution buffer (from the Zymo kit).

PCR amplify Omni-ATAC libraries:

25 μL

15 μL purified DNA

10 μL

Amplify for 5 cycles

72C 5min

98C 30 sec

Then, 5 cycles of:

98C 10 sec

63C 30 sec

72C 1 min

Place reaction on ice

Determine additional PCR cycles using qPCR:

qPCR mix 1 rxn

25 uM Nextera P1 0.25 μL

25 uM Nextera P2 0.25 μL

100X Syber Green I 0.09 μL

NEBnext 2X 5 μL

diH2O 4.4 μL

Purify DNA using using double size selection (0.5-1X ratio)

Assess tagmentation patterns using Libraries can be directly sequenced after this step.

Begin the ChIP-seq protocol at this step using the bead-bound nuclei obtained in Step 22.

After third wash, use a magnet to remove supernatant.

Resuspend bead-bound nuclei in 1 mL A1 buffer

Add to a final concentration of 1%. We use these small ampules for ChIP experiments and discard ~2 weeks after opening, storing at 4C.

Rotate for 2 min at RT

Add Glycine to a final concentration of 125 mM for quenching and rotate for 5 min at RT

Resuspend in 140 uL of Nuclei Lysis Buffer

Transfer to sonication tube (MicroTube (6x16mm), AFA fiber with Snap-Cap 520045)

Sonicate chromatin with E220 Covaris

Conditions: 10 min with 2% duty cycle 105W, 200 CPB

Transfer the sonicated lysate to an eppendorf tube using a magnet to discard beads

Add X-ChIP dilution buffer to make up to 1mL final volume.

Centrifuge supernatant 10min at 20,000 x g at 4C.

Transfer supernatant [soluble chromatin] to new centrifuge tube on ice

Take a 5% fraction (for input prep go to step 51.1) and flash-freeze remaining chromatin in liquid nitrogen or continue to step 52

Fill up to 200 µL with X-ChIP elution buffer

Add 2 µL of and incubate at 37C for 1 hour

Add 2 µL of and incubate at 55C overnight. It is important to do this incubation step at 55C (not higher temp).

Purify DNA using and quantify 2 µL using

Divide soluble chromatin based on number of antibodies to be used and fill up each tube to 1 mL with X-ChIP dilution buffer. We recommend using ~100ng equivalent of DNA (chromatin) per antibody for histone mark antibodies ( eg H3K4me3 ), but lower amounts may be sufficient for bulk histone ( eg histone H3 ). Higher amounts may be required depending on the epitope of interest.

Add 1 μg antibody of interest and incubate at 4C with constant rotation overnight

Day 2

Wash 25 µL of beads with 1 mL of X-ChIP dilution buffer to get rid of the slurry

Immuno-precipitate the antibody-chromatin complex with 25 µL G agarose beads (Santa Cruz) for 2 hours at 4C

Wash the beads with the following buffers for 5 min at RT with constant rotation: Low Salt Buffer, High Salt Buffer, LiCl Wash Buffer. Use 1 mL of each wash buffer, and remove supernatant using magnet as in other steps.

After LiCl wash, resuspend beads in 1 mL of TE buffer and transfer to new centrifuge tube (1.5 mL tube).

Incubate for 5 minutes at 4C

Using a magnet, remove supernatant and resuspend beads in 200 µL of X-ChIP Elution buffer

Extract the DNA from each ChIP sample obtained at step 60 using the same method as described for the input fraction (5%): steps 51.2 to 51.4 (RNAse, proteinaseK, purification).

Use purified DNA for library construction. We use and have found that 100 pg and 2 ng of DNA yield comparable libraries.

If nuclei will be used for CUT&Tag, perform the nuclear immuno-enrichment (starting at step 3) using instead of since Protein G coupled dynabeads might interfere with downstream steps in CUT&Tag.

After third wash, remove supernatant using a magnet and wash nuclei with 1 mL of cold Antibody 150 buffer three times

Using magnet, remove supernatant, resuspend bead-bound nuclei in 50 μL Antibody 150 buffer and transfer to PCR tube

Add 0.5 μg Primary antibody and gently pipette up and down to mix

Incubate for 1 hour at RT at 4C with constant rotation

Using magnet, remove supernatant, resuspend bead-bound nuclei in 50 µL cold Digitonin 150 buffer

Add 0.5 μg Secondary antibody

Incubate for 30 min at RT with constant rotation

Using a magnet, remove supernatant and add 200 μL cold Digitonin 150 Buffer

Repeat step 70 two times

Remove from magnet, add 50 μL cold Digitonin 300 buffer

Add 2.5 μL and pipette up and down to mix

Incubate samples for 1 hour at RT with constant rotation

Using a magnet, remove supernatant and add 200 μL cold Digitonin 300 buffer. Thoroughly resuspend by pipetting, return to magnet then pipet to remove supe

Repeat previous step for total of two washes

Remove from magnet, add 50 μL cold Tagmentation Buffer

Incubate for 1 hour at 37C in thermocycler

Using a magnet, remove supernatant and resuspend beads in 50 μL RT TAPS Buffer

Using a magnet, remove supernatant, add 5 uL RT SDS Release Buffer and vortex on max speed for 7 seconds. Quick spin to collect

Add 15 μL RT SDS Quench Buffer and vortex on max speed.

Add 2 μL each of Universal i5 and barcoded i7 primers (10 μM stocks)

Add 25 μL and mix

Amplify in a thermocycler using the following conditons:

a. 58C - 5 min

b. 72C - 5 min

c. 98C - 45 sec

d. 98C - 15 sec

e. 60C - 10 sec

f. Repeat d-e for a total of 14-21.

g. 72C - 1min

h. hold at 4C

We have found that 20 cycles yield optimal libraries when a H3K4me3 CUT&Tag reaction is started using nuclei corresponding to 100 ng gDNA

Clean CUT&Tab libraries using 1.3X am

Elute DNA in 15 μL and quantify using

CUT&Tag libraries are ready for sequencing