Generation of CRISPR constructs
Thanh Ngoc Nguyen
Abstract
This protocol details the procedure of generation of CRISPR constructs.
Attachments
Steps
Procedure
Designing gRNAs using https://chopchop.cbu.uib.no.
“Target”: Put in the gene name/“In”: choose the species.
Do not change anything in “General” tab.
In the “Cas9” tab, make sure you choose “No requirements” for “5’ requirements for sgRNA” and tick “I intend to replace the leading nucleotides with “GG”” (3 options of the “Sef-complementarity (Thyme et al.)” should be ticked).
In “Primers” tab, I choose product size from 200 to 500 and minimum distance from primer to target site at least 100.
Click “Find target sites”.
Choose the top-ranking gRNA sequences that target the earliest exon possible.
Click on the chosen target sequence, another window with all the information related to this gRNA sequence will appear.
Copy the target sequence without the PAM into the highlighted region of the below sequence:
Order the above sequence as a primer for Gibson assembly.
Preparing cut pSpCas9(BB)-2A-GFP:
Cut the vector with BbsI:
10µgof vectors2µLof BbsI3µLof NEBuffer™ r1.1- Add sterile milliQ water to
30µL - Incubate for 6-8 hours at
37°C
After that, add 1µL of CIP and incubate for no longer than 1h 0m 0s.
Heat de-activate at 60°C for 0h 5m 0s.
Run the reaction on a 0.5 % DNA agarose gel.
Extract the cut vector, determine the concentration, dilute it to 10ng/µl and aliquot to 1µL aliquots and store at -20°C.
Dilute the primer from steps 4 and 5 to the final concentration of 0.8micromolar (µM) (1/125 dilution of the 100micromolar (µM) stock). Set up a Gibson assembly reaction as following:
1µLof the diluted primers1µLof BbsI-linearised pSpCas9(BB)-2A-GFP2µLof HiFi DNA Assembly Master Mix- Incubate at
50°Cfor2h 0m 0s.
Transform 1.8µL of the mix from step 7 (the rest can be stored at -20°C as a backup in case the transformation does not result in any colonies) using 10µL of the NEB® 5-alpha Competent E. coli cells with manufacturer’s instructions.
The next day, pick up a few colonies and set up overnight cultures in growth broth.
Miniprep the cultures to purify plasmids and send them for sequencing using this primer (5’ GCTCACCTCGACCATGGTAAT 3’).
Once sequenced verified, the CRISPR constructs are now ready to be used for transfection.