Gene editing of YIPF4 in hESCs V3
Harper JW, sharan_swarup, Kelsey Hickey
Abstract
This protocol describes the creation of YIPF4 knockout hESCs.
Steps
Cell line maintenance
Maintain H9 human embryonic stem cells (AAVS1-TRE3G-NGN2 hESCs) in complete (E8 media).
Targeted knock-out of YIPF4
For YIPF4 knock-out, the following sgRNA sequences was designed and ordered from Synthego (5’ AAGAGGTTATGGCTGGCTTC 3').
0.6 μg sgRNA was incubated with 3 μg SpCas9 protein for 10 mins at room temperature and electroporated into 2 × 105 H9 cells using Neon transfection system (Thermo Fisher Scientific).
Deletions were verified by DNA sequencing with Illumina MiSeq (F: GTTCAATAGCATCCCCAGATGT and R: TCATCCCACAGACTAGCTCAAA) and by immunoblotting with a YIPF4 antibody (Sino Biological 202844-T46).