DNA metabarcoding protocol for siphonophore gut contents

Mainly identical to:

http://www.bea.ki.se/documents/EN-DNeasy%20handbook.pdf

With the following modifications:

-Digestion at 56°C

-Elution using 2 rounds of incubation and centrifuge with 50µL , incubating 0h 10m 0s at 56°C , to a total of 100µL

-Label 2mL Eppendorf tubes to hold the extracted DNA. Include the extraction number, the siphonophore species, "GCDNA", the date of extraction, and your initials.

-Use Nanodrop to assess DNA yield (ng/µl) and 260:280 ratio.

Equipment

Value	Label
NanoDrop™ 3300 Fluorospectrometer	NAME
Fluorospectrometer	TYPE
NanoDrop™ 3300	BRAND
nd-3300	SKU

Store eluted DNA in -20°C freezer.

Based off Promega GoTaq protocol.

(Plan for a 96-well final plate [90 wells used for 13 templates, a positive, and a negative control, across 6 primer pairs (detailed in T1)], can be re-scaled as needed).

See reference planning spreadsheet here: https://docs.google.com/spreadsheets/d/1x71z9YLqxo9XszNcjAPB__p0cnHHYyMTEHNL4wb84j4/edit#gid=656913706

Only select templates that have a DNA yield > 10ng/µl and a 260:280 > 1.7

A	B	C	D	E	F	G	H	I	J	K	L	M	N
Original Name	Type (F/R)	Barcode Region	Primer sequence	Length (bp)	TM © min	TM © max	%GC	Hairpin TMC	Self Dimer TMC	Pair Dimer TMC	Insert size (bp)	Start position	End position
152F	F	V5-V7S	TGACGGAAGGGCACCACCAG	20	62.7	64.6	63.2	63	0.1	None	152	1187	1207
152R	R	V5-V7S	TCCACCAACTAAGAACGGCC	20	60	60	55	None	None	None	152	1319	1339
166F	F	V3	AACGGCTACCACATCCAAGG	20	60	60	55	None	None	None	146	420	440
166R	R	V3	CACCAGACTTGCCCTCCAAT	20	60	60	55	31.9	None	None	146	546	566
272F	F	V5-V7L	AAACGATGCCGACTAGCGAT	20	59.9	59.9	50	44.6	7.9	6.7	272	1067	1087
272R	R	V5-V7L	TCCACCAACTAAGAACGGCC	20	60	60	55	None	None	6.7	272	1319	1339
179F	F	V7	GGCCGTTCTTAGTTGGTGGA	20	60	60	55	None	None	11	170	1319	1339
179R	R	V7	TGCGGCCCAGAACATCTAAG	20	60.1	60.1	55	None	None	11	170	1469	1489
261F	F	V7p+V8	AACAGGTCTGTGATGCCCTT	20	59.2	59.2	50	44.1	4.2	14	215	1472	1492
261R	R	V7p+V8	TGTGTACAAAGGGCAGGGAC	20	59.9	59.9	55	None	None	14	215	1667	1687
134F	F	V9	CTTTGTACACACCGCCCGTC	20	61.6	61.6	60	None	None	None	115	1675	1695
134R	R	V9	CCTTGTTACGACTTTTACTTCCTCT	25	58.8	58.8	40	None	None	None	115	1765	1790

T1. Primer sequences and properties. Positions based on the 18S Gene of Lymnaea diaphana (GenBank JF909497.1).

-Pull all reagents in T2 from the freezer and let them thaw.

-Separate and label two PCR plates,

one for V9 (annealing at `48°C` for `0h 0m 45s`  per cycle)



one for V3, V5-V7S, V5-V7L, V7, and V7p+V8 (all annealing at `54°C` for `0h 1m 0s` x30 cycles ). Divide and label each pair of rows that will contain each primer pair mix.

A	B
Reagent	Volume (µm)
Template (variable)	2
Forward primer (10µM)	0.5
Reverse primer (10µM)	0.5
MgCl2 (25mM)	2.5
dNTPs (10mM)	1
GoTaq	0.2
Buffer 5X (green)	2.5
BSA	1
H2O	14.8
TOTAL	25

T2. Reagent breakdown goal per well in the plate.

-Make master-mastermix for all primer pairs as in T3. Always vortex each reagent before pipetting, and vortex the mixture at the end.

A	B
Reagent	Volume (µm)
MgCl2 (25mM)	350
dNTPs (10mM)	140
GoTaq	28
Buffer 5X	350
BSA	140
H2O	2072
TOTAL	3080

T3. Master-mastermix volumes for 6 primer pair mastermixes downstream.

-Serve 440µL of this master-mastermix into 6 2mL Eppendorf tubes. Lable the tubes with the name of each primer pair.

-Add 10µL of 10micromolar (µM) Forward and 10µL of 10micromolar (µM) Reverse primer into each primer-specific mastermix to end up with T4.

-Vortex .

A	B
Reagent	Volume (µl)
Forward primer (10µM)	10
Reverse primer (10µM)	10
MgCl2 (25mM)	50
dNTPs (10mM)	20
GoTaq	4
Buffer 5X	50
BSA	20
H2O	296
TOTAL	460

T4. Volumes in primer pair mastermix.

In a set of 14 PCR tubes (can use two rows in either PCR plate too), serve an excess amount of template to seed each well with. I usually go for 20µL . Serve the templates in the same spatial arrangement as they will be seeded in each set of rows for each primer pair.

Include the positive and negative controls. I tend to pick the elution AE buffer stock I used for extractions as negative control, and a previously successful template as positive control.

Using a single 200µL pipette tip on a multi-step pipette set to 23µL doses in 4 steps, seed each primer-specific pair of rows. Remember to get rid of the excess (before or after serving the steps, depending on the model of the pipette). Change tips in between primer-pair-specific mastermix.

Using a multichannel 10-100µl, seed the 2µL of template in each well. Be careful to not accidentally aspire air at the bottom of the tubes/wells and end up with un-seeded wells. Always visually inspect the tips defore serving into the wells. Change tips every time to avoid contamination.

Seal the plates (0h 0m 6s under the plate press) with cellophane cover.

Vortex plates.

1000rpm and spin it down.

Insert plates (V9) and (V3, V5-V7S, V5-V7L, V7, V7p+V8) in two separate thermocyclers. Run PCRs following the programs specified in T5A and T5B respectively.

Equipment

Value	Label
SimpliAmp Thermal Cycler	NAME
PCR	TYPE
Applied Biosystems	BRAND
A24811	SKU
Any standard PCR thermocycler will suffice	SPECIFICATIONS

A	B	C	D	E	F
Temperature (C)	95	95	48	72	72
Time	2m	30s	45s	1m	5m
Cycles		x30	x30	x30

T5A. PCR program for barcode V9.

A	B	C	D	E	F
Temperature (C)	95	95	54	72	72
Time	2m	30s	1m	1m	5m
Cycles		x30	x30	x30

T5B. PCR program for barcodes V3, V5-V7S, V5-V7L, V7, and V7p+V8.

Vortex plates.

1000rpm and spin it down.

Un-seal the plates (0h 0m 6s under the plate press)

2g of Agarose for every 100mL of TAE buffer.

For 90 wells, we will need 3 gels with 2 16-well combs each.

For 3 gels, we need to make 200mL of agar in one batch, and 100mL in another batch.

In the double batch, add 4g of agarose and 200mL of TAE buffer. Microwave for 0h 3m 0s. Stir and microwave for another 0h 1m 0s if solids are still not dissolved. When cool, add 4µL of SYBR-Safe.

In the single batch, add 2g of agarose and 100mL of TAE buffer. Microwave for 0h 2m 30s. Stir and microwave for another 0h 1m 0s if solids are still not dissolved. When cool, add 2µL of SYBR-Safe.

Pour gels and let them cool until solid.

Annotate distribution of samples on wells. I usually arrange a row per primer pair ordered by amplicon size: V9:V5-V7S, V3:V7, V7p+V8:V5-V7L in 3 gels, and then the well sequence would go: Ladder, A1-B6 (letters vary with position in the PCR plate), -ve, +ve.

Set up power source to 125V, 500mA, 0h 45m 0s

Load 6µL of 100bp ladder on the left side of each row of wells (2 per gel).

Use adjustable-spacer multichannel pipette to load 5µL of PCR products onto the wells.

Well distance is 6.25 mm , PCR plate distance is 9 mm .

Run gels.

Place gels under UV light, take photograph, print.

Put some nuclease-free water to warm up to 56°C .

Add 55µL of water into each PCR well (except controls and failed reactions) using a multichannel 20-200µl and filter tips. Mix by pipetting up and down ~5 times. Transfer mix to ExcelaPure purification plate. Change tips every time.

5000rpm Centrifuge the purification plate with a collecting plate underneath.

Make sure to balance the plate centrifuge with a couple of adequately weighted collecting plates.

Add 50µL of warm (56°C ) water to each well in the purification plate. Mix by pipetting up and down ~15 times with the multichannel pipette and filter tips. Change tips every time.

Incubate at 56°C for 0h 10m 0s .

Prepare a final clean product PCR plate: Label and annotate adequately to preserve sample location. I recommend drawing a line between each pair of rows, segregating primer pairs for barcodes V3 to V9.

Mix the warm eluted clean products in the purification plates by pipetting up and down ~15 times with the multichannel pipette and filter tips.

Transfer clean products to the final plate.

Change tips every time.

Seal the plates (0h 0m 6s under the hot plate press) with cellophane cover. Store in -20°C freezer.

The goal here is to obtain an equal concentration of each barcode for each sample, so they can be pooled with equal representation for MiSeq Illumina sequencing.

First step is to quantify the DNA content in each cleaned PCR product well using Qubit HS.

Equipment

Value	Label
Qubit 2.0 Fluorometer instrument	BRAND
Q33226	SKU
with Qubit RNA HS Assays	SPECIFICATIONS

If you have the pre-mixed mastermix, just run the standards at 190µL of mastermix and 10µL of standard.

Vortex mix and incubate for 1min.

Prepare the assay tubes with 198µL MM and 2µLof template.

Vortex mix and incubate for 1min.

Pick the ng/µl units.

-Calculate amount of template to seed in each pooling well.

-Pool target concentrations are equal to the lowest concentration across barcodes for a sample excluding those that are <2ng/µl, which is the minimum required by YCGA for amplicon sequencing.

A	B	C	D	E	F
V9	V5-V7S	V3	V7	V7p+V8	V5-V7L
0.5	0.5	0.6	0.6	0.9	1

T6. Molar correction factors for each barcode based on the molecular weight of each expected amplicon length.

Template volume to add = (50µL /(Qubit ng/µl value of original PCR product/Pool target concentration))*Molar_correction_factor

~ See T6 for Molar correction factors ~

-Calculate amount of water to add in each pooling well.

Water volume to add = (50µL *Molar_correction_factor) - Template volume to add

Prepare a pooling PCR plate, labeled.

Add the water and template quantities for each well. Change the pipette tip every time when handling PCR products.

Label Eppendorf 2mL tubes to hold to final amplicon pools. Include the extraction number, the genus of the siphonophore, "GC DNA pooled", and your initials.

Using a multichannel pipette of 20-200µl, proceed to pool the amplicons by sample. If the volumes do not fit in a row on the pooling PCR plate, you can make 2 semi-pools, one combining V9:V5-V7S:V3, and one combining V7:V7p+V8:V5-V7L.

Using a single-channel 20-200µl pipette, transfer the pooled amplicons to the Eppendorf tubes. Vortex and close caps.

Store the amplicon pools in a -20°C freezer.